| Variant ID: vg0500172077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 172077 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 120. )
ATGAATGTGAACATCTATCATCGTATTAATAATTACACGTCTTTCGGCAAACACATAAAGTCAAATTGATCTTATAAGGCTGTGATTGCAATCCCATTTT[C/T]
CCGATCCCTCTCCCTCATTTTCCGCTCGCACGCTTTTCAAACTACTAAACAGTGAATTTTTTATAAAAAATTTCTATACAAAAGTTATTTAAAAAAAATC
GATTTTTTTTAAATAACTTTTGTATAGAAATTTTTTATAAAAAATTCACTGTTTAGTAGTTTGAAAAGCGTGCGAGCGGAAAATGAGGGAGAGGGATCGG[G/A]
AAAATGGGATTGCAATCACAGCCTTATAAGATCAATTTGACTTTATGTGTTTGCCGAAAGACGTGTAATTATTAATACGATGATAGATGTTCACATTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 23.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 65.20% | 34.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 55.40% | 44.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.40% | 16.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 45.70% | 54.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 65.00% | 34.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500172077 | C -> T | LOC_Os05g01240.1 | upstream_gene_variant ; 4355.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500172077 | C -> T | LOC_Os05g01250.1 | upstream_gene_variant ; 2361.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500172077 | C -> T | LOC_Os05g01240.4 | upstream_gene_variant ; 4143.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500172077 | C -> T | LOC_Os05g01240.5 | upstream_gene_variant ; 4143.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500172077 | C -> T | LOC_Os05g01240-LOC_Os05g01250 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500172077 | NA | 8.55E-06 | mr1115 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | 6.47E-06 | NA | mr1156 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | 1.61E-06 | 2.35E-09 | mr1156 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | NA | 6.88E-09 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | 4.59E-06 | 4.58E-06 | mr1162 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | 2.36E-06 | 7.39E-10 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | NA | 6.24E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | NA | 2.41E-09 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | NA | 2.07E-06 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500172077 | NA | 3.74E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/