Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500171547:

Variant ID: vg0500171547 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 171547
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CAATAAGACATGGCTTTTATTAATGGTGAAATTGGTGTTGGTAATTCCGGACCAACCGGCTACGTACCGTTCTGATTTCATTTAGGAGTACCTTTTCTTT[T/C]
TTCCAATTGAACCATCTGACAATGGTTATCAACAAAAACAGGTGAAAATAGTAAAAAAAAAAGAAAGCAAATAGAAACACAAATGATTTTTCTGCCCCAC

Reverse complement sequence

GTGGGGCAGAAAAATCATTTGTGTTTCTATTTGCTTTCTTTTTTTTTTACTATTTTCACCTGTTTTTGTTGATAACCATTGTCAGATGGTTCAATTGGAA[A/G]
AAAGAAAAGGTACTCCTAAATGAAATCAGAACGGTACGTAGCCGGTTGGTCCGGAATTACCAACACCAATTTCACCATTAATAAAAGCCATGTCTTATTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	17.20%	0.06%	0.00%	NA
All Indica	2759	70.70%	29.20%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	84.70%	15.10%	0.17%	0.00%	NA
Indica II	465	82.40%	17.60%	0.00%	0.00%	NA
Indica III	913	53.20%	46.70%	0.11%	0.00%	NA
Indica Intermediate	786	73.50%	26.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500171547	T -> C	LOC_Os05g01240.1	upstream_gene_variant ; 3825.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500171547	T -> C	LOC_Os05g01250.1	upstream_gene_variant ; 2891.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500171547	T -> C	LOC_Os05g01240.3	upstream_gene_variant ; 4678.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500171547	T -> C	LOC_Os05g01240.2	upstream_gene_variant ; 4545.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500171547	T -> C	LOC_Os05g01240.4	upstream_gene_variant ; 3613.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500171547	T -> C	LOC_Os05g01240.5	upstream_gene_variant ; 3613.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500171547	T -> C	LOC_Os05g01240-LOC_Os05g01250	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500171547	NA	5.28E-08	mr1156	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	1.82E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	4.77E-08	mr1179	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	8.18E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	5.52E-06	mr1510	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	5.79E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	5.05E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	6.64E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	8.64E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	5.77E-09	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	5.71E-07	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	1.12E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	1.11E-07	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	8.14E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	4.95E-06	mr1702_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	1.75E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	2.53E-07	7.08E-07	mr1740_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	3.16E-07	3.10E-09	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	1.38E-06	mr1741_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	7.53E-06	mr1751_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	6.06E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	1.07E-06	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	2.72E-07	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	4.86E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	NA	2.17E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500171547	8.64E-06	NA	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251