Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500074042:

Variant ID: vg0500074042 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 74042
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATATTGTACAGGTTTGTTTATTTTATGATGAAGAGAACATATGATACTACATCTTTTTTTTTTATTATGACACCGTTGACTTTTTGAAAAACTATGAT[C/A]
ATTCGTCTTATTTAACTATTTTTTGCAAAATAGAAAAAATCAAGTCATACTTAAAGAATATTTGATAATAAATCAAGTCACAATAAAATAAATAATAGTA

Reverse complement sequence

TACTATTATTTATTTTATTGTGACTTGATTTATTATCAAATATTCTTTAAGTATGACTTGATTTTTTCTATTTTGCAAAAAATAGTTAAATAAGACGAAT[G/T]
ATCATAGTTTTTCAAAAAGTCAACGGTGTCATAATAAAAAAAAAAGATGTAGTATCATATGTTCTCTTCATCATAAAATAAACAAACCTGTACAATATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	2.00%	1.21%	35.32%	NA
All Indica	2759	43.50%	0.10%	0.40%	55.96%	NA
All Japonica	1512	87.90%	6.10%	2.91%	3.11%	NA
Aus	269	81.80%	0.00%	0.37%	17.84%	NA
Indica I	595	19.50%	0.00%	0.34%	80.17%	NA
Indica II	465	35.10%	0.20%	0.43%	64.30%	NA
Indica III	913	63.90%	0.00%	0.33%	35.82%	NA
Indica Intermediate	786	43.10%	0.30%	0.51%	56.11%	NA
Temperate Japonica	767	88.00%	2.90%	3.91%	5.22%	NA
Tropical Japonica	504	96.60%	3.00%	0.40%	0.00%	NA
Japonica Intermediate	241	69.30%	22.80%	4.98%	2.90%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	72.20%	1.10%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500074042	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01040.1	upstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01050.1	upstream_gene_variant ; 705.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01040.3	upstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01040.2	upstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01040.4	upstream_gene_variant ; 4093.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01050.2	upstream_gene_variant ; 819.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01050.3	upstream_gene_variant ; 705.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01060.1	downstream_gene_variant ; 1143.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01060.2	downstream_gene_variant ; 1143.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500074042	C -> A	LOC_Os05g01050-LOC_Os05g01060	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500074042	NA	4.85E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500074042	7.31E-06	7.31E-06	mr1542_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500074042	1.79E-06	1.79E-06	mr1973_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251