Variant ID: vg0500057378 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 57378 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )
TTTTGTAATGTGATTCTTTTCTTCAACCGCATACTTGATCTTGATAACATATTGTAGTAATATTTAACGCCGTTGACTTTTTAAAATATGTTTGATCATT[C/T]
GTCTTATTCATAAACTTTTGTGAAATATATAAAACTATATGTATACATAAAAATATATTTAACAATGAATTAAATGATAAAAAAAAGAATTAATAATTAC
GTAATTATTAATTCTTTTTTTTATCATTTAATTCATTGTTAAATATATTTTTATGTATACATATAGTTTTATATATTTCACAAAAGTTTATGAATAAGAC[G/A]
AATGATCAAACATATTTTAAAAAGTCAACGGCGTTAAATATTACTACAATATGTTATCAAGATCAAGTATGCGGTTGAAGAAAAGAATCACATTACAAAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 82.60% | 17.20% | 0.11% | 0.00% | NA |
All Indica | 2759 | 70.60% | 29.20% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 84.40% | 15.30% | 0.34% | 0.00% | NA |
Indica II | 465 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 53.20% | 46.70% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 73.40% | 26.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0500057378 | C -> T | LOC_Os05g01030.1 | upstream_gene_variant ; 3443.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0500057378 | C -> T | LOC_Os05g01020-LOC_Os05g01030 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0500057378 | NA | 3.75E-08 | mr1156 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 3.93E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 1.58E-08 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 9.89E-10 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 1.19E-07 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 7.67E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 7.53E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 4.25E-06 | mr1630 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 7.73E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500057378 | NA | 3.33E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/