| Variant ID: vg0500026688 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26688 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 99. )
TCTAGGATAGCATCTAGCATCTCCTTTATGCTTTATTCAGTTTGGATGCTCTTTAGGACAACATTGCGTTCAAATTTTAGACTAGAGTGGGCAGCAATTA[G/A]
CTTGCAGCCATCCAGCCAGCTATGGCTATATATATGTATCCGACCTCCCCCCGGGATGGTATGGCTTTTGGGTTTGTGAATGAACAAAACCAGAAAATTG
CAATTTTCTGGTTTTGTTCATTCACAAACCCAAAAGCCATACCATCCCGGGGGGAGGTCGGATACATATATATAGCCATAGCTGGCTGGATGGCTGCAAG[C/T]
TAATTGCTGCCCACTCTAGTCTAAAATTTGAACGCAATGTTGTCCTAAAGAGCATCCAAACTGAATAAAGCATAAAGGAGATGCTAGATGCTATCCTAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.90% | 19.90% | 0.74% | 0.47% | NA |
| All Indica | 2759 | 66.90% | 31.80% | 0.51% | 0.76% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 72.90% | 20.10% | 7.06% | 0.00% | NA |
| Indica I | 595 | 84.70% | 15.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 74.40% | 25.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 48.50% | 48.60% | 0.66% | 2.19% | NA |
| Indica Intermediate | 786 | 70.50% | 28.80% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500026688 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500026688 | G -> A | LOC_Os05g00998.1 | upstream_gene_variant ; 1170.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500026688 | G -> A | LOC_Os05g01002.1 | upstream_gene_variant ; 482.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500026688 | G -> A | LOC_Os05g01006.1 | downstream_gene_variant ; 26.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500026688 | G -> A | LOC_Os05g01002-LOC_Os05g01006 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500026688 | NA | 1.21E-06 | mr1045 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 1.96E-07 | mr1156 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 5.06E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 2.41E-07 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 2.62E-06 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 7.27E-07 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 7.31E-06 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 8.07E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | NA | 9.25E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500026688 | 6.17E-06 | 1.85E-07 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/