Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500026327:

Variant ID: vg0500026327 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26327
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTGTGGAGAGGGGTAAGGGAAAGGGGAAGGAGGAGCAGCTGGTGCTGCTGCTGCTGCTGGCTGAGAGCTCAACCGAGCTTGGGAAGGGGTGGAACAAG[A/T]
GATGTTTAGCCTACAGGAAAGTGTGGCTCTAATACCGGATGTTAGAATTTCAATGGTTACTCATTGAAAAGAGGATGGCACTCAGGATGGGGCAATTTTC

Reverse complement sequence

GAAAATTGCCCCATCCTGAGTGCCATCCTCTTTTCAATGAGTAACCATTGAAATTCTAACATCCGGTATTAGAGCCACACTTTCCTGTAGGCTAAACATC[T/A]
CTTGTTCCACCCCTTCCCAAGCTCGGTTGAGCTCTCAGCCAGCAGCAGCAGCAGCACCAGCTGCTCCTCCTTCCCCTTTCCCTTACCCCTCTCCACACAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	17.10%	0.70%	0.44%	NA
All Indica	2759	69.80%	29.00%	0.47%	0.72%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.07%	NA
Aus	269	92.60%	0.40%	7.06%	0.00%	NA
Indica I	595	84.90%	15.10%	0.00%	0.00%	NA
Indica II	465	82.20%	17.40%	0.43%	0.00%	NA
Indica III	913	50.70%	46.40%	0.77%	2.08%	NA
Indica Intermediate	786	73.20%	26.20%	0.51%	0.13%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500026327	A -> T	LOC_Os05g00998.1	upstream_gene_variant ; 809.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500026327	A -> T	LOC_Os05g01002.1	upstream_gene_variant ; 121.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500026327	A -> T	LOC_Os05g01006.1	downstream_gene_variant ; 387.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500026327	A -> T	LOC_Os05g01002-LOC_Os05g01006	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500026327	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500026327	NA	8.22E-07	mr1156	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	2.59E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	2.58E-07	mr1179	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	3.13E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	1.85E-06	mr1510	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	8.43E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	6.33E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	2.70E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	9.79E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	3.04E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	2.55E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	4.87E-06	NA	mr1156_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	9.54E-06	9.92E-08	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	3.73E-08	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	8.97E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	6.73E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	1.49E-06	2.23E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	2.39E-06	2.05E-08	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	6.19E-06	mr1741_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	1.41E-06	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	4.26E-07	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	2.07E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500026327	NA	1.31E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251