Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0435460049:

Variant ID: vg0435460049 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 35460049
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGCAACGGATACATTCTAGCATCGTTCGTTCAGGCCTTCAGGGAAGATAGGGGAGTCTGAAACTCGTTTTCTCCGCACACGCTTTTCAAACTATTAAAT[T/G]
GTGTGTTTTTTTCAAAAAAATAAGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAAATTTAAAATATTTAATACTCAATTAATCATGCGCTAAT

Reverse complement sequence

ATTAGCGCATGATTAATTGAGTATTAAATATTTTAAATTTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCTTATTTTTTTGAAAAAAACACAC[A/C]
ATTTAATAGTTTGAAAAGCGTGTGCGGAGAAAACGAGTTTCAGACTCCCCTATCTTCCCTGAAGGCCTGAACGAACGATGCTAGAATGTATCCGTTGCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	39.50%	0.21%	2.31%	NA
All Indica	2759	92.20%	3.60%	0.29%	3.88%	NA
All Japonica	1512	2.40%	97.60%	0.00%	0.00%	NA
Aus	269	48.30%	51.70%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	97.20%	1.10%	0.22%	1.51%	NA
Indica III	913	86.90%	2.70%	0.55%	9.86%	NA
Indica Intermediate	786	91.00%	7.50%	0.25%	1.27%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	6.20%	93.80%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	0.00%	1.04%	NA
Intermediate	90	28.90%	67.80%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0435460049	T -> DEL	N	N	silent_mutation	Average:73.374; most accessible tissue: Callus, score: 89.546	N	N	N	N
vg0435460049	T -> G	LOC_Os04g59624.2	upstream_gene_variant ; 185.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Callus, score: 89.546	N	N	N	N
vg0435460049	T -> G	LOC_Os04g59630.1	upstream_gene_variant ; 2500.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Callus, score: 89.546	N	N	N	N
vg0435460049	T -> G	LOC_Os04g59624.1	upstream_gene_variant ; 1900.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Callus, score: 89.546	N	N	N	N
vg0435460049	T -> G	LOC_Os04g59624.3	upstream_gene_variant ; 185.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Callus, score: 89.546	N	N	N	N
vg0435460049	T -> G	LOC_Os04g59624-LOC_Os04g59630	intergenic_region ; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Callus, score: 89.546	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0435460049	NA	4.42E-26	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	1.10E-36	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	6.11E-42	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	7.52E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	4.09E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	1.61E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	1.33E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	2.19E-14	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	2.73E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	3.57E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	7.93E-41	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	6.14E-34	mr1737	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	7.44E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	1.95E-28	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	1.64E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	3.80E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	6.31E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	8.14E-14	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049	NA	3.37E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251