\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0435460049:

Variant ID: vg0435460049 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 35460049
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCAACGGATACATTCTAGCATCGTTCGTTCAGGCCTTCAGGGAAGATAGGGGAGTCTGAAACTCGTTTTCTCCGCACACGCTTTTCAAACTATTAAAT[T/G]
GTGTGTTTTTTTCAAAAAAATAAGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAAATTTAAAATATTTAATACTCAATTAATCATGCGCTAAT

Reverse complement sequence

ATTAGCGCATGATTAATTGAGTATTAAATATTTTAAATTTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCTTATTTTTTTGAAAAAAACACAC[A/C]
ATTTAATAGTTTGAAAAGCGTGTGCGGAGAAAACGAGTTTCAGACTCCCCTATCTTCCCTGAAGGCCTGAACGAACGATGCTAGAATGTATCCGTTGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 39.50% 0.21% 2.31% NA
All Indica  2759 92.20% 3.60% 0.29% 3.88% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.20% 1.10% 0.22% 1.51% NA
Indica III  913 86.90% 2.70% 0.55% 9.86% NA
Indica Intermediate  786 91.00% 7.50% 0.25% 1.27% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 28.90% 67.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0435460049 T -> DEL N N silent_mutation Average:73.374; most accessible tissue: Callus, score: 89.546 N N N N
vg0435460049 T -> G LOC_Os04g59624.2 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Callus, score: 89.546 N N N N
vg0435460049 T -> G LOC_Os04g59630.1 upstream_gene_variant ; 2500.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Callus, score: 89.546 N N N N
vg0435460049 T -> G LOC_Os04g59624.1 upstream_gene_variant ; 1900.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Callus, score: 89.546 N N N N
vg0435460049 T -> G LOC_Os04g59624.3 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Callus, score: 89.546 N N N N
vg0435460049 T -> G LOC_Os04g59624-LOC_Os04g59630 intergenic_region ; MODIFIER silent_mutation Average:73.374; most accessible tissue: Callus, score: 89.546 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0435460049 NA 4.42E-26 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 1.10E-36 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 6.11E-42 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 7.52E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 4.09E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 1.61E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 1.33E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 2.19E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 2.73E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 3.57E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 7.93E-41 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 6.14E-34 mr1737 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 7.44E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 1.95E-28 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 1.64E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 3.80E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 6.31E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 8.14E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435460049 NA 3.37E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251