\
| Variant ID: vg0435372935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 35372935 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )
AGCATGCATATCAAAACTATATTGTGTCCATATCTATGTGTCAACTACTTGTTCTTATTCTTAAAATTTCAGTAGTTCGTTATGCTCACATTTTATTAGG[C/T]
GTCATCCATCTGATTTTAAATAAACTATCATCAGCTGCGATATAGGCAGTAGTTTCTTTTATGTTGATTAATGCTTTATTGAAGTTGTAACTATGGTGCA
TGCACCATAGTTACAACTTCAATAAAGCATTAATCAACATAAAAGAAACTACTGCCTATATCGCAGCTGATGATAGTTTATTTAAAATCAGATGGATGAC[G/A]
CCTAATAAAATGTGAGCATAACGAACTACTGAAATTTTAAGAATAAGAACAAGTAGTTGACACATAGATATGGACACAATATAGTTTTGATATGCATGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.30% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.90% | 6.90% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 77.80% | 19.60% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0435372935 | C -> T | LOC_Os04g59494.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.852; most accessible tissue: Callus, score: 79.699 | N | N | N | N |
| vg0435372935 | C -> T | LOC_Os04g59494.4 | intron_variant ; MODIFIER | silent_mutation | Average:51.852; most accessible tissue: Callus, score: 79.699 | N | N | N | N |
| vg0435372935 | C -> T | LOC_Os04g59494.2 | intron_variant ; MODIFIER | silent_mutation | Average:51.852; most accessible tissue: Callus, score: 79.699 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0435372935 | NA | 7.93E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 9.12E-06 | 9.11E-06 | mr1601 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | NA | 6.84E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 1.74E-06 | NA | mr1082_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 6.47E-07 | NA | mr1083_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 3.29E-06 | NA | mr1103_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 3.40E-06 | NA | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 2.17E-06 | NA | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 4.67E-06 | NA | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 1.83E-07 | NA | mr1226_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435372935 | 3.12E-06 | NA | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |