\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0435357013:

Variant ID: vg0435357013 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 35357013
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.27, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CGCACCAAATCCTATTTTTAAAGTCTAGCTCCGAAAAAAGAGAGAGAAAAAGCCCACTAGTTGACTTTTGTACACACATATGTATGCAAAGAAGACATAT[T/A]
TTCCAAAGATATATGACAATGAACTCAAAGGTAACAACTACTACTACTAAATACAAAGATGGAGAGCTTAGCCATGATTGCATCTGCACTTGCATTTGCC

Reverse complement sequence

GGCAAATGCAAGTGCAGATGCAATCATGGCTAAGCTCTCCATCTTTGTATTTAGTAGTAGTAGTTGTTACCTTTGAGTTCATTGTCATATATCTTTGGAA[A/T]
ATATGTCTTCTTTGCATACATATGTGTGTACAAAAGTCAACTAGTGGGCTTTTTCTCTCTCTTTTTTCGGAGCTAGACTTTAAAAATAGGATTTGGTGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.10% 0.06% 0.23% NA
All Indica  2759 86.20% 13.40% 0.11% 0.33% NA
All Japonica  1512 1.00% 98.90% 0.00% 0.07% NA
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 92.10% 7.70% 0.00% 0.17% NA
Indica II  465 95.30% 4.10% 0.00% 0.65% NA
Indica III  913 81.80% 18.10% 0.00% 0.11% NA
Indica Intermediate  786 81.30% 17.80% 0.38% 0.51% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 23.30% 75.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0435357013 T -> DEL N N silent_mutation Average:72.14; most accessible tissue: Callus, score: 91.873 N N N N
vg0435357013 T -> A LOC_Os04g59460.1 upstream_gene_variant ; 1386.0bp to feature; MODIFIER silent_mutation Average:72.14; most accessible tissue: Callus, score: 91.873 N N N N
vg0435357013 T -> A LOC_Os04g59480.1 upstream_gene_variant ; 3043.0bp to feature; MODIFIER silent_mutation Average:72.14; most accessible tissue: Callus, score: 91.873 N N N N
vg0435357013 T -> A LOC_Os04g59470.1 downstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:72.14; most accessible tissue: Callus, score: 91.873 N N N N
vg0435357013 T -> A LOC_Os04g59460-LOC_Os04g59470 intergenic_region ; MODIFIER silent_mutation Average:72.14; most accessible tissue: Callus, score: 91.873 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0435357013 NA 3.43E-61 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 5.06E-37 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 4.50E-39 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 3.42E-52 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 4.30E-48 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.19E-36 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 6.02E-48 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.60E-46 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.50E-54 mr1121 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 3.18E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.64E-44 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.13E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.12E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.18E-14 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 4.41E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.14E-32 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 3.57E-62 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.41E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.72E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.73E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 5.48E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.09E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 9.85E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.90E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 3.65E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.25E-33 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.15E-45 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 6.82E-59 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.20E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 2.28E-60 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 4.23E-51 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 7.08E-64 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 3.15E-50 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435357013 NA 1.60E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251