\
| Variant ID: vg0435357013 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 35357013 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.27, others allele: 0.00, population size: 222. )
CGCACCAAATCCTATTTTTAAAGTCTAGCTCCGAAAAAAGAGAGAGAAAAAGCCCACTAGTTGACTTTTGTACACACATATGTATGCAAAGAAGACATAT[T/A]
TTCCAAAGATATATGACAATGAACTCAAAGGTAACAACTACTACTACTAAATACAAAGATGGAGAGCTTAGCCATGATTGCATCTGCACTTGCATTTGCC
GGCAAATGCAAGTGCAGATGCAATCATGGCTAAGCTCTCCATCTTTGTATTTAGTAGTAGTAGTTGTTACCTTTGAGTTCATTGTCATATATCTTTGGAA[A/T]
ATATGTCTTCTTTGCATACATATGTGTGTACAAAAGTCAACTAGTGGGCTTTTTCTCTCTCTTTTTTCGGAGCTAGACTTTAAAAATAGGATTTGGTGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 48.10% | 0.06% | 0.23% | NA |
| All Indica | 2759 | 86.20% | 13.40% | 0.11% | 0.33% | NA |
| All Japonica | 1512 | 1.00% | 98.90% | 0.00% | 0.07% | NA |
| Aus | 269 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 95.30% | 4.10% | 0.00% | 0.65% | NA |
| Indica III | 913 | 81.80% | 18.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 81.30% | 17.80% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 23.30% | 75.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0435357013 | T -> DEL | N | N | silent_mutation | Average:72.14; most accessible tissue: Callus, score: 91.873 | N | N | N | N |
| vg0435357013 | T -> A | LOC_Os04g59460.1 | upstream_gene_variant ; 1386.0bp to feature; MODIFIER | silent_mutation | Average:72.14; most accessible tissue: Callus, score: 91.873 | N | N | N | N |
| vg0435357013 | T -> A | LOC_Os04g59480.1 | upstream_gene_variant ; 3043.0bp to feature; MODIFIER | silent_mutation | Average:72.14; most accessible tissue: Callus, score: 91.873 | N | N | N | N |
| vg0435357013 | T -> A | LOC_Os04g59470.1 | downstream_gene_variant ; 1589.0bp to feature; MODIFIER | silent_mutation | Average:72.14; most accessible tissue: Callus, score: 91.873 | N | N | N | N |
| vg0435357013 | T -> A | LOC_Os04g59460-LOC_Os04g59470 | intergenic_region ; MODIFIER | silent_mutation | Average:72.14; most accessible tissue: Callus, score: 91.873 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0435357013 | NA | 3.43E-61 | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 5.06E-37 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 4.50E-39 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 3.42E-52 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 4.30E-48 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.19E-36 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 6.02E-48 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.60E-46 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.50E-54 | mr1121 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 3.18E-49 | mr1125 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.64E-44 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.13E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.12E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.18E-14 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 4.41E-31 | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.14E-32 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 3.57E-62 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.41E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.72E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.73E-34 | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 5.48E-42 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.09E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 9.85E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.90E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 3.65E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.25E-33 | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.15E-45 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 6.82E-59 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.20E-38 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 2.28E-60 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 4.23E-51 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 7.08E-64 | mr1125_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 3.15E-50 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0435357013 | NA | 1.60E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |