\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434911930:

Variant ID: vg0434911930 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34911930
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACAGGCGGGAACCGGGGAAACACGCATCATAGAGCGGCTGATGCGAGTCGCTCTCTATGTTTGGTTTGGATTGAAATCAACTAGCGATTGCGCGGCTA[T/G]
CACCTAAACAAAATCATATATTTTTTATATAATTTTACTTAAATTTTATTAAATAGCTATCTTATTGTCTTAAGAGTTTGAAAGACCAAGTTTGAAAGAC

Reverse complement sequence

GTCTTTCAAACTTGGTCTTTCAAACTCTTAAGACAATAAGATAGCTATTTAATAAAATTTAAGTAAAATTATATAAAAAATATATGATTTTGTTTAGGTG[A/C]
TAGCCGCGCAATCGCTAGTTGATTTCAATCCAAACCAAACATAGAGAGCGACTCGCATCAGCCGCTCTATGATGCGTGTTTCCCCGGTTCCCGCCTGTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 15.60% 0.08% 0.91% NA
All Indica  2759 79.40% 19.00% 0.07% 1.56% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 37.90% 62.10% 0.00% 0.00% NA
Indica I  595 95.00% 3.20% 0.17% 1.68% NA
Indica II  465 49.70% 48.00% 0.00% 2.37% NA
Indica III  913 86.30% 13.30% 0.00% 0.44% NA
Indica Intermediate  786 77.20% 20.40% 0.13% 2.29% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434911930 T -> DEL N N silent_mutation Average:95.411; most accessible tissue: Minghui63 flag leaf, score: 98.817 N N N N
vg0434911930 T -> G LOC_Os04g58710.1 upstream_gene_variant ; 1269.0bp to feature; MODIFIER silent_mutation Average:95.411; most accessible tissue: Minghui63 flag leaf, score: 98.817 N N N N
vg0434911930 T -> G LOC_Os04g58720.1 upstream_gene_variant ; 3861.0bp to feature; MODIFIER silent_mutation Average:95.411; most accessible tissue: Minghui63 flag leaf, score: 98.817 N N N N
vg0434911930 T -> G LOC_Os04g58700.1 downstream_gene_variant ; 4565.0bp to feature; MODIFIER silent_mutation Average:95.411; most accessible tissue: Minghui63 flag leaf, score: 98.817 N N N N
vg0434911930 T -> G LOC_Os04g58700.2 downstream_gene_variant ; 4565.0bp to feature; MODIFIER silent_mutation Average:95.411; most accessible tissue: Minghui63 flag leaf, score: 98.817 N N N N
vg0434911930 T -> G LOC_Os04g58710-LOC_Os04g58720 intergenic_region ; MODIFIER silent_mutation Average:95.411; most accessible tissue: Minghui63 flag leaf, score: 98.817 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434911930 T G 0.03 0.04 0.02 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434911930 NA 2.07E-112 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 3.43E-111 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 2.74E-70 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 1.72E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 1.14E-27 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 5.11E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 5.49E-114 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 4.84E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 2.13E-06 6.74E-86 mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 1.14E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 4.86E-20 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 1.46E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 9.37E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 4.64E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 1.84E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 4.27E-35 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 3.59E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 7.24E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434911930 NA 1.60E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251