\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434885431:

Variant ID: vg0434885431 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34885431
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCGAATTTAGCTTCAGTGTCAACAATTTCACCATATCCTCCTTCATTTTCAGTTTCTTCCTCCTCCATAGTCACCAGATACACCTGCTTGTTGGCCTT[A/G]
CACACTTTCCCATGCCCAGGAACCCAAGGTTCTTGGCATCTAAAGCATTTGCCATTCCACTTAATTTTTCCACCAGTCTCATTTTTATCATCCTTTCCCT

Reverse complement sequence

AGGGAAAGGATGATAAAAATGAGACTGGTGGAAAAATTAAGTGGAATGGCAAATGCTTTAGATGCCAAGAACCTTGGGTTCCTGGGCATGGGAAAGTGTG[T/C]
AAGGCCAACAAGCAGGTGTATCTGGTGACTATGGAGGAGGAAGAAACTGAAAATGAAGGAGGATATGGTGAAATTGTTGACACTGAAGCTAAATTCGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.30% 3.80% 1.06% 60.79% NA
All Indica  2759 7.30% 1.30% 1.70% 89.67% NA
All Japonica  1512 86.90% 0.00% 0.00% 13.10% NA
Aus  269 1.50% 37.90% 0.74% 59.85% NA
Indica I  595 6.60% 0.30% 2.86% 90.25% NA
Indica II  465 6.00% 0.60% 1.29% 92.04% NA
Indica III  913 4.40% 0.80% 1.20% 93.65% NA
Indica Intermediate  786 12.00% 3.20% 1.65% 83.21% NA
Temperate Japonica  767 95.20% 0.00% 0.00% 4.82% NA
Tropical Japonica  504 91.90% 0.00% 0.00% 8.13% NA
Japonica Intermediate  241 50.20% 0.00% 0.00% 49.79% NA
VI/Aromatic  96 55.20% 33.30% 1.04% 10.42% NA
Intermediate  90 56.70% 10.00% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434885431 A -> DEL N N silent_mutation Average:12.298; most accessible tissue: Callus, score: 66.26 N N N N
vg0434885431 A -> G LOC_Os04g58640.1 upstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:12.298; most accessible tissue: Callus, score: 66.26 N N N N
vg0434885431 A -> G LOC_Os04g58650.1 upstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:12.298; most accessible tissue: Callus, score: 66.26 N N N N
vg0434885431 A -> G LOC_Os04g58650-LOC_Os04g58680 intergenic_region ; MODIFIER silent_mutation Average:12.298; most accessible tissue: Callus, score: 66.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434885431 NA 1.36E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 8.04E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 9.58E-08 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 2.41E-06 NA mr1059 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 3.68E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 2.38E-08 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 7.96E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 2.06E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 6.04E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 2.55E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 2.83E-06 mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 4.63E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 2.11E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 8.78E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 8.72E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 5.28E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 5.71E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 1.49E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 9.05E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 NA 9.34E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434885431 9.73E-06 1.13E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251