\
| Variant ID: vg0434884835 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34884835 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 77. )
AACCTCTTCAGGAGTTTCCCCTTTTCTCCCTTCATCCTCCTGAACTGGTTTTAAGTGCAATACTGTTCCAGCCATTCCTTGATCTACCCATTTCTCCAGC[T/A]
TGTGCATGCTAATCAAGAAATTCCTTACAGGAACTGACACATCTGAGAGCACCAAGGTGTGTCCATCCTTACTCATAGTCAACTCTTTAGTTTTAAGATT
AATCTTAAAACTAAAGAGTTGACTATGAGTAAGGATGGACACACCTTGGTGCTCTCAGATGTGTCAGTTCCTGTAAGGAATTTCTTGATTAGCATGCACA[A/T]
GCTGGAGAAATGGGTAGATCAAGGAATGGCTGGAACAGTATTGCACTTAAAACCAGTTCAGGAGGATGAAGGGAGAAAAGGGGAAACTCCTGAAGAGGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 14.60% | 0.38% | 47.52% | NA |
| All Indica | 2759 | 7.70% | 18.10% | 0.47% | 73.69% | NA |
| All Japonica | 1512 | 86.90% | 0.30% | 0.26% | 12.57% | NA |
| Aus | 269 | 37.90% | 61.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 5.40% | 2.70% | 0.67% | 91.26% | NA |
| Indica II | 465 | 5.80% | 48.20% | 0.43% | 45.59% | NA |
| Indica III | 913 | 4.70% | 13.10% | 0.11% | 82.04% | NA |
| Indica Intermediate | 786 | 14.10% | 17.80% | 0.76% | 67.30% | NA |
| Temperate Japonica | 767 | 95.20% | 0.10% | 0.26% | 4.43% | NA |
| Tropical Japonica | 504 | 91.90% | 0.00% | 0.00% | 8.13% | NA |
| Japonica Intermediate | 241 | 50.20% | 1.20% | 0.83% | 47.72% | NA |
| VI/Aromatic | 96 | 88.50% | 9.40% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 65.60% | 11.10% | 1.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434884835 | T -> DEL | LOC_Os04g58650.1 | N | frameshift_variant | Average:34.057; most accessible tissue: Callus, score: 61.369 | N | N | N | N |
| vg0434884835 | T -> A | LOC_Os04g58650.1 | missense_variant ; p.Lys139Met; MODERATE | nonsynonymous_codon ; K139M | Average:34.057; most accessible tissue: Callus, score: 61.369 | unknown | unknown | DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434884835 | NA | 8.57E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 3.99E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.46E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.02E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 8.38E-07 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 9.50E-07 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 3.63E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 4.16E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | 4.50E-06 | 4.50E-06 | mr1562 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 4.75E-10 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 3.52E-08 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.19E-08 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 3.70E-08 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 6.10E-10 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.30E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.68E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 2.41E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.11E-07 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 5.14E-07 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 5.21E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 1.86E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434884835 | NA | 5.93E-07 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |