\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434884835:

Variant ID: vg0434884835 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34884835
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTCTTCAGGAGTTTCCCCTTTTCTCCCTTCATCCTCCTGAACTGGTTTTAAGTGCAATACTGTTCCAGCCATTCCTTGATCTACCCATTTCTCCAGC[T/A]
TGTGCATGCTAATCAAGAAATTCCTTACAGGAACTGACACATCTGAGAGCACCAAGGTGTGTCCATCCTTACTCATAGTCAACTCTTTAGTTTTAAGATT

Reverse complement sequence

AATCTTAAAACTAAAGAGTTGACTATGAGTAAGGATGGACACACCTTGGTGCTCTCAGATGTGTCAGTTCCTGTAAGGAATTTCTTGATTAGCATGCACA[A/T]
GCTGGAGAAATGGGTAGATCAAGGAATGGCTGGAACAGTATTGCACTTAAAACCAGTTCAGGAGGATGAAGGGAGAAAAGGGGAAACTCCTGAAGAGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 14.60% 0.38% 47.52% NA
All Indica  2759 7.70% 18.10% 0.47% 73.69% NA
All Japonica  1512 86.90% 0.30% 0.26% 12.57% NA
Aus  269 37.90% 61.70% 0.00% 0.37% NA
Indica I  595 5.40% 2.70% 0.67% 91.26% NA
Indica II  465 5.80% 48.20% 0.43% 45.59% NA
Indica III  913 4.70% 13.10% 0.11% 82.04% NA
Indica Intermediate  786 14.10% 17.80% 0.76% 67.30% NA
Temperate Japonica  767 95.20% 0.10% 0.26% 4.43% NA
Tropical Japonica  504 91.90% 0.00% 0.00% 8.13% NA
Japonica Intermediate  241 50.20% 1.20% 0.83% 47.72% NA
VI/Aromatic  96 88.50% 9.40% 0.00% 2.08% NA
Intermediate  90 65.60% 11.10% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434884835 T -> DEL LOC_Os04g58650.1 N frameshift_variant Average:34.057; most accessible tissue: Callus, score: 61.369 N N N N
vg0434884835 T -> A LOC_Os04g58650.1 missense_variant ; p.Lys139Met; MODERATE nonsynonymous_codon ; K139M Average:34.057; most accessible tissue: Callus, score: 61.369 unknown unknown DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434884835 NA 8.57E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 3.99E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.46E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.02E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 8.38E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 9.50E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 3.63E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 4.16E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 4.50E-06 4.50E-06 mr1562 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 4.75E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 3.52E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.19E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 3.70E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 6.10E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.30E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.68E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 2.41E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.11E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 5.14E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 5.21E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 1.86E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434884835 NA 5.93E-07 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251