\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434883119:

Variant ID: vg0434883119 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34883119
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTAATTTTTACTTTTATAAACATAATCTTTTGAGAGCTATTTGGTGGTTAAAGTTTTGAAAAATTAAATCTGGAGTGGTTGTCATTTTCTTGTATATG[A/C,T]
AGATGCAAATGTCTTTTTAAATGGAGTGATGGATGCAACTAGAGTCTCTTTCCTTTTCTTAGAGATTTTTTTTAATCTTTTAGGAAAGGACGAAGGAAGA

Reverse complement sequence

TCTTCCTTCGTCCTTTCCTAAAAGATTAAAAAAAATCTCTAAGAAAAGGAAAGAGACTCTAGTTGCATCCATCACTCCATTTAAAAAGACATTTGCATCT[T/G,A]
CATATACAAGAAAATGACAACCACTCCAGATTTAATTTTTCAAAACTTTAACCACCAAATAGCTCTCAAAAGATTATGTTTATAAAAGTAAAAATTACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 32.30% 0.15% 0.00% NA
All Indica  2759 95.40% 4.50% 0.18% 0.00% NA
All Japonica  1512 13.60% 86.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 97.00% 2.60% 0.43% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 91.20% 8.50% 0.25% 0.00% NA
Temperate Japonica  767 5.30% 94.70% 0.00% 0.00% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434883119 A -> C LOC_Os04g58640.1 upstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0434883119 A -> C LOC_Os04g58650.1 downstream_gene_variant ; 1295.0bp to feature; MODIFIER silent_mutation Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0434883119 A -> C LOC_Os04g58640-LOC_Os04g58650 intergenic_region ; MODIFIER silent_mutation Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0434883119 A -> T LOC_Os04g58640.1 upstream_gene_variant ; 1481.0bp to feature; MODIFIER N Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0434883119 A -> T LOC_Os04g58650.1 downstream_gene_variant ; 1295.0bp to feature; MODIFIER N Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0434883119 A -> T LOC_Os04g58640-LOC_Os04g58650 intergenic_region ; MODIFIER N Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434883119 1.41E-06 NA mr1064 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 8.18E-07 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 1.54E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 2.44E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 5.54E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 3.90E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 2.57E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 1.53E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 1.63E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 1.63E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 3.07E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 2.91E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 2.73E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 1.89E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 9.75E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 9.88E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 7.92E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 3.61E-16 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 7.00E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 5.80E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 4.72E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 7.74E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119 NA 2.03E-07 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251