Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434883119:

Variant ID: vg0434883119 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34883119
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAATTTTTACTTTTATAAACATAATCTTTTGAGAGCTATTTGGTGGTTAAAGTTTTGAAAAATTAAATCTGGAGTGGTTGTCATTTTCTTGTATATG[A/C,T]
AGATGCAAATGTCTTTTTAAATGGAGTGATGGATGCAACTAGAGTCTCTTTCCTTTTCTTAGAGATTTTTTTTAATCTTTTAGGAAAGGACGAAGGAAGA

Reverse complement sequence

TCTTCCTTCGTCCTTTCCTAAAAGATTAAAAAAAATCTCTAAGAAAAGGAAAGAGACTCTAGTTGCATCCATCACTCCATTTAAAAAGACATTTGCATCT[T/G,A]
CATATACAAGAAAATGACAACCACTCCAGATTTAATTTTTCAAAACTTTAACCACCAAATAGCTCTCAAAAGATTATGTTTATAAAAGTAAAAATTACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	32.30%	0.15%	0.00%	NA
All Indica	2759	95.40%	4.50%	0.18%	0.00%	NA
All Japonica	1512	13.60%	86.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.80%	2.00%	0.17%	0.00%	NA
Indica II	465	97.00%	2.60%	0.43%	0.00%	NA
Indica III	913	96.50%	3.50%	0.00%	0.00%	NA
Indica Intermediate	786	91.20%	8.50%	0.25%	0.00%	NA
Temperate Japonica	767	5.30%	94.70%	0.00%	0.00%	NA
Tropical Japonica	504	8.10%	91.90%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	50.00%	47.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434883119	A -> C	LOC_Os04g58640.1	upstream_gene_variant ; 1481.0bp to feature; MODIFIER	silent_mutation	Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0434883119	A -> C	LOC_Os04g58650.1	downstream_gene_variant ; 1295.0bp to feature; MODIFIER	silent_mutation	Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0434883119	A -> C	LOC_Os04g58640-LOC_Os04g58650	intergenic_region ; MODIFIER	silent_mutation	Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0434883119	A -> T	LOC_Os04g58640.1	upstream_gene_variant ; 1481.0bp to feature; MODIFIER	N	Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0434883119	A -> T	LOC_Os04g58650.1	downstream_gene_variant ; 1295.0bp to feature; MODIFIER	N	Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0434883119	A -> T	LOC_Os04g58640-LOC_Os04g58650	intergenic_region ; MODIFIER	N	Average:44.328; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434883119	1.41E-06	NA	mr1064	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	8.18E-07	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	1.54E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	2.44E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	5.54E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	3.90E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	2.57E-14	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	1.53E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	1.63E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	1.63E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	3.07E-06	mr1534	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	2.91E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	2.73E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	1.89E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	9.75E-08	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	9.88E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	7.92E-24	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	3.61E-16	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	7.00E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	5.80E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	4.72E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	7.74E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434883119	NA	2.03E-07	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251