\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434837711:

Variant ID: vg0434837711 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34837711
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTGATGGATTAGATTAAATCCAATCCCTTTTTCCCTGGTTACTACTAGCCCATTTTCTTTCAAAAGAAATACTACAATGTAGAGTCTATAAAAAAAT[A/G]
TTATCTAGTACAGTAGAGAACATGTTACCTTTAAACTTTCTGACAACAATTAGATAAGAACAAACAAAACAAAAACATTGCACCGATAGAAGCTTCTTGT

Reverse complement sequence

ACAAGAAGCTTCTATCGGTGCAATGTTTTTGTTTTGTTTGTTCTTATCTAATTGTTGTCAGAAAGTTTAAAGGTAACATGTTCTCTACTGTACTAGATAA[T/C]
ATTTTTTTATAGACTCTACATTGTAGTATTTCTTTTGAAAGAAAATGGGCTAGTAGTAACCAGGGAAAAAGGGATTGGATTTAATCTAATCCATCAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.60% 0.30% 0.00% NA
All Indica  2759 94.50% 5.00% 0.43% 0.00% NA
All Japonica  1512 1.40% 98.60% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.10% 2.40% 0.50% 0.00% NA
Indica II  465 98.10% 1.50% 0.43% 0.00% NA
Indica III  913 94.30% 5.70% 0.00% 0.00% NA
Indica Intermediate  786 90.70% 8.40% 0.89% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 55.20% 1.04% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434837711 A -> G LOC_Os04g58590.1 upstream_gene_variant ; 368.0bp to feature; MODIFIER silent_mutation Average:64.229; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0434837711 A -> G LOC_Os04g58600.2 upstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:64.229; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0434837711 A -> G LOC_Os04g58590-LOC_Os04g58600 intergenic_region ; MODIFIER silent_mutation Average:64.229; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434837711 A G 0.0 -0.01 -0.01 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434837711 NA 5.57E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 2.45E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 3.26E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 9.98E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 6.37E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 1.05E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 3.18E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 6.36E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 6.80E-08 NA mr1090_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 5.93E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 1.94E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 1.00E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434837711 NA 1.22E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251