Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434823384:

Variant ID: vg0434823384 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34823384
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, T: 0.23, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGCTTTTTCAAAAAGTTACTCCCCCATCGTTTGGCTTTTTTCTTATAAACCAAAACGGTTTATTAGGGAATAAAAATAAATTTATAGGTAAACGTTTT[A/T]
TATATGTGTTCTTGGTGACTTAAAGCCAATGCTGTAAAAGAAACTACGTTGAAAATATCTCAAAATCAATCTCAAATTTAAATTTAAAAATTCAAATTTT

Reverse complement sequence

AAAATTTGAATTTTTAAATTTAAATTTGAGATTGATTTTGAGATATTTTCAACGTAGTTTCTTTTACAGCATTGGCTTTAAGTCACCAAGAACACATATA[T/A]
AAAACGTTTACCTATAAATTTATTTTTATTCCCTAATAAACCGTTTTGGTTTATAAGAAAAAAGCCAAACGATGGGGGAGTAACTTTTTGAAAAAGCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.70% 0.08% 0.00% NA
All Indica  2759 93.50% 6.40% 0.11% 0.00% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 40.90% 58.70% 0.37% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 93.50% 6.50% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 12.50% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434823384 A -> T LOC_Os04g58560.1 upstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58564.2 upstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58570.1 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58580.1 upstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58560.2 upstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58564.1 upstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58564.3 upstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58580.2 upstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N
vg0434823384 A -> T LOC_Os04g58564-LOC_Os04g58570 intergenic_region ; MODIFIER silent_mutation Average:92.785; most accessible tissue: Zhenshan97 flower, score: 97.306 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434823384 A T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434823384 NA 3.93E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 6.14E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 3.31E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 9.09E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.19E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 2.17E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 3.62E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.93E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 2.96E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 2.33E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 6.05E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 4.76E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 2.82E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.09E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.20E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 6.88E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.38E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 9.94E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 4.47E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.17E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 6.32E-23 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 4.16E-08 mr1642_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.10E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.81E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 3.85E-06 2.97E-06 mr1686_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 2.75E-06 mr1817_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 4.01E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 8.34E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.30E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 1.96E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 3.24E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434823384 NA 3.39E-42 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251