Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434821738:

Variant ID: vg0434821738 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34821738
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.35, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTGTGGCTTTCTTGAGGGGGAAGGAAGAGCCCATGCTCCAAGAGACCTTCTTTGCCTTAATCTGCATGTGATTCAGTTAGCACTAGAAAGTATGACG[G/A]
CACAGAAGCATTAACACATATTGTGGCACTAGATCACTCACAGTAACAGAATGCTCGCTATCCTGGGAACTTGCAGCAGAAGCTTGCACGTCAACAAATC

Reverse complement sequence

GATTTGTTGACGTGCAAGCTTCTGCTGCAAGTTCCCAGGATAGCGAGCATTCTGTTACTGTGAGTGATCTAGTGCCACAATATGTGTTAATGCTTCTGTG[C/T]
CGTCATACTTTCTAGTGCTAACTGAATCACATGCAGATTAAGGCAAAGAAGGTCTCTTGGAGCATGGGCTCTTCCTTCCCCCTCAAGAAAGCCACAAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 38.10% 8.65% 11.47% NA
All Indica  2759 6.70% 59.40% 14.46% 19.39% NA
All Japonica  1512 98.60% 1.10% 0.13% 0.20% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 2.50% 65.70% 19.16% 12.61% NA
Indica II  465 1.50% 59.60% 17.85% 21.08% NA
Indica III  913 6.70% 56.60% 11.06% 25.63% NA
Indica Intermediate  786 13.00% 57.90% 12.85% 16.28% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 1.80% 0.40% 0.40% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 1.04% NA
Intermediate  90 62.20% 25.60% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434821738 G -> DEL N N silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N
vg0434821738 G -> A LOC_Os04g58560.1 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N
vg0434821738 G -> A LOC_Os04g58570.1 upstream_gene_variant ; 2687.0bp to feature; MODIFIER silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N
vg0434821738 G -> A LOC_Os04g58560.2 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N
vg0434821738 G -> A LOC_Os04g58564.2 intron_variant ; MODIFIER silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N
vg0434821738 G -> A LOC_Os04g58564.1 intron_variant ; MODIFIER silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N
vg0434821738 G -> A LOC_Os04g58564.3 intron_variant ; MODIFIER silent_mutation Average:37.581; most accessible tissue: Zhenshan97 flower, score: 93.832 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434821738 G A -0.02 0.0 0.01 -0.02 -0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434821738 NA 7.70E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 3.34E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 3.36E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 7.73E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 8.25E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 1.43E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 4.86E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 4.80E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 2.35E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 7.22E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 7.46E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 5.38E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 2.86E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 2.90E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 5.87E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 4.36E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 1.10E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 5.13E-09 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 1.19E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 1.81E-07 mr1642_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 2.20E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 6.11E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 1.47E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 5.05E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 1.02E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 7.53E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 8.21E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 2.88E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 7.13E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434821738 NA 9.67E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251