Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434817544:

Variant ID: vg0434817544 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34817544
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTCTGCCTCTATGTTATCAGCTGCAATATCAACTGCCTGAGATGTAGAGAACACCCCACTGTAACTACCATAGCTCAAAAATGAAAAACAAAAATAGC[T/C]
CCCTAGTCATTACATTGATAAATACAAAATCCATCTACTTCTACAAGGTTACTAACCAAAATGGATTCCAAGCAAAAAGGGATACTGCAAAAATAGCCAG

Reverse complement sequence

CTGGCTATTTTTGCAGTATCCCTTTTTGCTTGGAATCCATTTTGGTTAGTAACCTTGTAGAAGTAGATGGATTTTGTATTTATCAATGTAATGACTAGGG[A/G]
GCTATTTTTGTTTTTCATTTTTGAGCTATGGTAGTTACAGTGGGGTGTTCTCTACATCTCAGGCAGTTGATATTGCAGCTGATAACATAGAGGCAGACAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	37.10%	0.13%	0.04%	NA
All Indica	2759	94.30%	5.50%	0.22%	0.04%	NA
All Japonica	1512	13.60%	86.40%	0.00%	0.00%	NA
Aus	269	41.60%	58.40%	0.00%	0.00%	NA
Indica I	595	97.80%	1.80%	0.34%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	94.30%	5.70%	0.00%	0.00%	NA
Indica Intermediate	786	89.30%	10.20%	0.38%	0.13%	NA
Temperate Japonica	767	5.20%	94.80%	0.00%	0.00%	NA
Tropical Japonica	504	8.30%	91.70%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	42.20%	56.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434817544	T -> C	LOC_Os04g58550.1	upstream_gene_variant ; 4017.0bp to feature; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> C	LOC_Os04g58555.1	upstream_gene_variant ; 2330.0bp to feature; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> C	LOC_Os04g58564.2	downstream_gene_variant ; 3001.0bp to feature; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> C	LOC_Os04g58564.1	downstream_gene_variant ; 3001.0bp to feature; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> C	LOC_Os04g58564.3	downstream_gene_variant ; 3001.0bp to feature; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> C	LOC_Os04g58560.1	intron_variant ; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> C	LOC_Os04g58560.2	intron_variant ; MODIFIER	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N
vg0434817544	T -> DEL	N	N	silent_mutation	Average:56.687; most accessible tissue: Callus, score: 80.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434817544	NA	8.20E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	9.45E-22	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	8.68E-08	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	3.48E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	7.55E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	1.50E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	7.16E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	5.61E-33	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	7.67E-30	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	1.40E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	3.80E-06	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	1.58E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	4.57E-06	2.56E-30	mr1825_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434817544	NA	1.17E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251