Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0434804978:

Variant ID: vg0434804978 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34804978
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GACGAAGATCCAGCTACCCTAACCTAGGTCAAATGTCTGCTGATCTGCTCATCAATGGCTATGGTGTAATCATCATCAGTATCATCTCCTATCTTATATG[G/A]
TGCTCCACTTAAAACTTGCATACAGATGTATTTACTTAGGCTCTGATGGGGAACCTAGCGCATGATTAATTAAATATTAGCTAAAATAAATTTAAAAAAT

Reverse complement sequence

ATTTTTTAAATTTATTTTAGCTAATATTTAATTAATCATGCGCTAGGTTCCCCATCAGAGCCTAAGTAAATACATCTGTATGCAAGTTTTAAGTGGAGCA[C/T]
CATATAAGATAGGAGATGATACTGATGATGATTACACCATAGCCATTGATGAGCAGATCAGCAGACATTTGACCTAGGTTAGGGTAGCTGGATCTTCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.10% 0.02% 0.00% NA
All Indica  2759 98.60% 1.40% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 39.40% 60.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434804978 G -> A LOC_Os04g58504.1 upstream_gene_variant ; 4223.0bp to feature; MODIFIER silent_mutation Average:64.047; most accessible tissue: Callus, score: 83.557 N N N N
vg0434804978 G -> A LOC_Os04g58530.1 upstream_gene_variant ; 2155.0bp to feature; MODIFIER silent_mutation Average:64.047; most accessible tissue: Callus, score: 83.557 N N N N
vg0434804978 G -> A LOC_Os04g58520.1 downstream_gene_variant ; 102.0bp to feature; MODIFIER silent_mutation Average:64.047; most accessible tissue: Callus, score: 83.557 N N N N
vg0434804978 G -> A LOC_Os04g58540.1 downstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:64.047; most accessible tissue: Callus, score: 83.557 N N N N
vg0434804978 G -> A LOC_Os04g58520-LOC_Os04g58530 intergenic_region ; MODIFIER silent_mutation Average:64.047; most accessible tissue: Callus, score: 83.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434804978 NA 5.33E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 5.82E-08 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 3.00E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 3.14E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 5.11E-08 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.99E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 1.29E-06 2.28E-10 mr1073 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 4.63E-06 6.59E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 1.70E-06 NA mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 9.00E-06 NA mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 3.06E-17 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 3.19E-06 9.52E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.19E-18 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 1.82E-07 3.41E-26 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 8.60E-09 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 7.98E-06 mr1127 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.66E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.29E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 6.04E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.33E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 2.24E-07 1.82E-20 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.43E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.92E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.24E-06 mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.62E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 6.41E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 4.47E-06 4.47E-06 mr1357 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 3.76E-09 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 3.27E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 8.52E-07 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.74E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 7.79E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 5.08E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.08E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.69E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.08E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 2.62E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 4.76E-06 3.08E-17 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.45E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.20E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 7.97E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.52E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 5.90E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.13E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 8.89E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 6.30E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.09E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.61E-09 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.01E-08 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 6.14E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 3.18E-07 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 7.05E-06 NA mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.04E-08 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 1.54E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 2.04E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 7.26E-20 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 3.84E-06 5.06E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 9.28E-06 NA mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 4.81E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 8.27E-06 NA mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 9.69E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 2.08E-06 1.24E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434804978 NA 6.06E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251