\
| Variant ID: vg0434769084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34769084 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCTTTATTGATACTGTAAGGGTGCTTACAGGTATGAATGATATTGACTCATACAAAGAATTTACGTAGTTGGTCAATGTTCCAAGAATTTGCTAATTCG[C/T]
GACCGTCGCCGTCTGCGATTTTGAATGCGCCTGGCCGCAAGACTTGTGTGATCGTGTAAGGTCCTTCCCATTTAGGTGAGAGTTTGTTTTGCCCTGCTTG
CAAGCAGGGCAAAACAAACTCTCACCTAAATGGGAAGGACCTTACACGATCACACAAGTCTTGCGGCCAGGCGCATTCAAAATCGCAGACGGCGACGGTC[G/A]
CGAATTAGCAAATTCTTGGAACATTGACCAACTACGTAAATTCTTTGTATGAGTCAATATCATTCATACCTGTAAGCACCCTTACAGTATCAATAAAGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434769084 | C -> T | LOC_Os04g58450.1 | missense_variant ; p.Arg1712His; MODERATE | nonsynonymous_codon ; R1712H | Average:19.762; most accessible tissue: Zhenshan97 root, score: 41.416 | benign |
0.688 |
TOLERATED | 0.10 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434769084 | NA | 1.77E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 8.37E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 7.52E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 2.61E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 2.85E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 5.85E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | 4.68E-07 | NA | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 3.22E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 3.68E-06 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 4.78E-08 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 8.70E-07 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | 2.99E-07 | NA | mr1550_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434769084 | NA | 5.58E-17 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |