\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434768530:

Variant ID: vg0434768530 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34768530
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGTGACAAATATCTTAGGAAAAGATGTAATGTAGCGAAAGATTTGTGAAAAAACTGTAAGGAGTATTTTGTGAATAAAGAAATCTATCTTTGACAAAT[G/A]
TCTCTTACTCTGGATGTCATGTGTAAGAGTGCGTTCTCGGTTAACGACTTTAGTCAGCCGTTTGATTCGTACACTCTCCCTAGCCCCTAGCCTTGTCGTC

Reverse complement sequence

GACGACAAGGCTAGGGGCTAGGGAGAGTGTACGAATCAAACGGCTGACTAAAGTCGTTAACCGAGAACGCACTCTTACACATGACATCCAGAGTAAGAGA[C/T]
ATTTGTCAAAGATAGATTTCTTTATTCACAAAATACTCCTTACAGTTTTTTCACAAATCTTTCGCTACATTACATCTTTTCCTAAGATATTTGTCACAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.60% 0.25% 0.00% NA
All Indica  2759 98.80% 0.80% 0.40% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 40.90% 59.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 97.10% 1.80% 1.15% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434768530 G -> A LOC_Os04g58430.1 upstream_gene_variant ; 2204.0bp to feature; MODIFIER silent_mutation Average:27.875; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N
vg0434768530 G -> A LOC_Os04g58440.1 downstream_gene_variant ; 305.0bp to feature; MODIFIER silent_mutation Average:27.875; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N
vg0434768530 G -> A LOC_Os04g58450.1 downstream_gene_variant ; 502.0bp to feature; MODIFIER silent_mutation Average:27.875; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N
vg0434768530 G -> A LOC_Os04g58440-LOC_Os04g58450 intergenic_region ; MODIFIER silent_mutation Average:27.875; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434768530 NA 1.48E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 2.08E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 5.71E-06 2.52E-09 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 1.06E-09 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 4.75E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 6.06E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 8.62E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 3.85E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 4.65E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 1.30E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 1.35E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 6.17E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 1.32E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 5.96E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 NA 1.24E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 3.82E-07 5.94E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 6.52E-07 1.16E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 1.13E-06 5.86E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 3.27E-06 7.58E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 1.25E-07 1.56E-07 mr1497_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 1.91E-06 4.83E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 1.45E-06 NA mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 2.26E-06 1.27E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434768530 9.30E-06 NA mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251