RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0434765473:

Variant ID: vg0434765473 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34765473
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGGCTCGCTTTTCGGCGACCTTCTATCGGCAATGGACCTCGGCAAATCAGCTTCCACTAGTGCAACGTTGAAGAAACTCCAGGAGGATGGCGCTCTTC[C/T]
TGGCCATGGAACCATGGAGAGGGAAGCAGGAGGTACTAATCCTCAGCCCATATTGGGTCGCATGGTTGCGATCGAAGATTATGTTCTCTGCGGTTTTCTC

Reverse complement sequence

GAGAAAACCGCAGAGAACATAATCTTCGATCGCAACCATGCGACCCAATATGGGCTGAGGATTAGTACCTCCTGCTTCCCTCTCCATGGTTCCATGGCCA[G/A]
GAAGAGCGCCATCCTCCTGGAGTTTCTTCAACGTTGCACTAGTGGAAGCTGATTTGCCGAGGTCCATTGCCGATAGAAGGTCGCCGAAAAGCGAGCCTAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	5.00%	16.50%	7.47%	NA
All Indica	2759	64.60%	1.40%	27.55%	6.45%	NA
All Japonica	1512	88.30%	0.00%	0.60%	11.11%	NA
Aus	269	39.80%	59.90%	0.37%	0.00%	NA
Indica I	595	55.60%	0.30%	38.82%	5.21%	NA
Indica II	465	74.00%	0.60%	22.15%	3.23%	NA
Indica III	913	61.70%	0.90%	27.93%	9.53%	NA
Indica Intermediate	786	69.30%	3.20%	21.76%	5.73%	NA
Temperate Japonica	767	96.30%	0.00%	0.00%	3.65%	NA
Tropical Japonica	504	92.30%	0.00%	1.59%	6.15%	NA
Japonica Intermediate	241	54.40%	0.00%	0.41%	45.23%	NA
VI/Aromatic	96	67.70%	31.20%	0.00%	1.04%	NA
Intermediate	90	73.30%	8.90%	11.11%	6.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434765473	C -> DEL	LOC_Os04g58430.1	N	frameshift_variant	Average:24.58; most accessible tissue: Callus, score: 31.541	N	N	N	N
vg0434765473	C -> T	LOC_Os04g58430.1	missense_variant ; p.Arg285Lys; MODERATE	nonsynonymous_codon ; R285K	Average:24.58; most accessible tissue: Callus, score: 31.541	unknown	unknown	TOLERATED	0.66

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434765473	NA	7.27E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	NA	2.09E-07	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	NA	9.91E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	NA	2.24E-07	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	NA	6.37E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	NA	4.32E-09	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	3.12E-06	5.29E-23	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	2.67E-07	4.13E-29	mr1098	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	6.37E-06	NA	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765473	5.78E-06	1.25E-25	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 66 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg0434765473:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact