Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0434765214:

Variant ID: vg0434765214 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34765214
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAGTCGAGCACACCATTTGAAGCTCAACGGTCACGAGCGAATTTTAAACTGAAGTCCAAAAAACCGCCGCGCGTAACGGGACCAGAAATTTCCGGCGG[A/G]
CATCTCTCTCTGTTCCCTGGAATTCGCACCGTCGGTAGTGCGCCTATTTAAAGGAATTTTGGGAGTCCATCTTGAAGTCCGCCAAACCTGTTAAACACAC

Reverse complement sequence

GTGTGTTTAACAGGTTTGGCGGACTTCAAGATGGACTCCCAAAATTCCTTTAAATAGGCGCACTACCGACGGTGCGAATTCCAGGGAACAGAGAGAGATG[T/C]
CCGCCGGAAATTTCTGGTCCCGTTACGCGCGGCGGTTTTTTGGACTTCAGTTTAAAATTCGCTCGTGACCGTTGAGCTTCAAATGGTGTGCTCGACTACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	34.50%	3.77%	2.07%	NA
All Indica	2759	92.80%	3.80%	2.65%	0.80%	NA
All Japonica	1512	1.20%	87.00%	6.81%	4.96%	NA
Aus	269	60.20%	39.80%	0.00%	0.00%	NA
Indica I	595	97.00%	2.20%	0.50%	0.34%	NA
Indica II	465	96.60%	2.60%	0.86%	0.00%	NA
Indica III	913	90.00%	4.40%	4.82%	0.77%	NA
Indica Intermediate	786	90.50%	5.10%	2.80%	1.65%	NA
Temperate Japonica	767	0.30%	95.60%	1.30%	2.87%	NA
Tropical Japonica	504	2.60%	91.90%	4.17%	1.39%	NA
Japonica Intermediate	241	1.20%	49.80%	29.88%	19.09%	NA
VI/Aromatic	96	35.40%	64.60%	0.00%	0.00%	NA
Intermediate	90	51.10%	45.60%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434765214	A -> DEL	N	N	silent_mutation	Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0434765214	A -> G	LOC_Os04g58440.1	upstream_gene_variant ; 2107.0bp to feature; MODIFIER	silent_mutation	Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0434765214	A -> G	LOC_Os04g58420.1	downstream_gene_variant ; 1723.0bp to feature; MODIFIER	silent_mutation	Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0434765214	A -> G	LOC_Os04g58430.1	downstream_gene_variant ; 207.0bp to feature; MODIFIER	silent_mutation	Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0434765214	A -> G	LOC_Os04g58450.1	downstream_gene_variant ; 3818.0bp to feature; MODIFIER	silent_mutation	Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0434765214	A -> G	LOC_Os04g58420-LOC_Os04g58430	intergenic_region ; MODIFIER	silent_mutation	Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434765214	1.19E-07	NA	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	2.17E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	4.29E-07	1.31E-17	mr1116	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	2.33E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	1.66E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	6.21E-06	NA	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	2.45E-08	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	4.21E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	2.19E-06	NA	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	3.61E-16	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	1.05E-22	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	1.31E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	3.49E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	1.18E-45	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	3.89E-07	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	2.72E-07	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214	NA	1.81E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251