\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434765214:

Variant ID: vg0434765214 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34765214
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAGTCGAGCACACCATTTGAAGCTCAACGGTCACGAGCGAATTTTAAACTGAAGTCCAAAAAACCGCCGCGCGTAACGGGACCAGAAATTTCCGGCGG[A/G]
CATCTCTCTCTGTTCCCTGGAATTCGCACCGTCGGTAGTGCGCCTATTTAAAGGAATTTTGGGAGTCCATCTTGAAGTCCGCCAAACCTGTTAAACACAC

Reverse complement sequence

GTGTGTTTAACAGGTTTGGCGGACTTCAAGATGGACTCCCAAAATTCCTTTAAATAGGCGCACTACCGACGGTGCGAATTCCAGGGAACAGAGAGAGATG[T/C]
CCGCCGGAAATTTCTGGTCCCGTTACGCGCGGCGGTTTTTTGGACTTCAGTTTAAAATTCGCTCGTGACCGTTGAGCTTCAAATGGTGTGCTCGACTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 34.50% 3.77% 2.07% NA
All Indica  2759 92.80% 3.80% 2.65% 0.80% NA
All Japonica  1512 1.20% 87.00% 6.81% 4.96% NA
Aus  269 60.20% 39.80% 0.00% 0.00% NA
Indica I  595 97.00% 2.20% 0.50% 0.34% NA
Indica II  465 96.60% 2.60% 0.86% 0.00% NA
Indica III  913 90.00% 4.40% 4.82% 0.77% NA
Indica Intermediate  786 90.50% 5.10% 2.80% 1.65% NA
Temperate Japonica  767 0.30% 95.60% 1.30% 2.87% NA
Tropical Japonica  504 2.60% 91.90% 4.17% 1.39% NA
Japonica Intermediate  241 1.20% 49.80% 29.88% 19.09% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 51.10% 45.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434765214 A -> DEL N N silent_mutation Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0434765214 A -> G LOC_Os04g58440.1 upstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0434765214 A -> G LOC_Os04g58420.1 downstream_gene_variant ; 1723.0bp to feature; MODIFIER silent_mutation Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0434765214 A -> G LOC_Os04g58430.1 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0434765214 A -> G LOC_Os04g58450.1 downstream_gene_variant ; 3818.0bp to feature; MODIFIER silent_mutation Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0434765214 A -> G LOC_Os04g58420-LOC_Os04g58430 intergenic_region ; MODIFIER silent_mutation Average:31.832; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434765214 1.19E-07 NA mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 2.17E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 4.29E-07 1.31E-17 mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 2.33E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 1.66E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 6.21E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 2.45E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 4.21E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 2.19E-06 NA mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 3.61E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 1.05E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 1.31E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 3.49E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 1.18E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 3.89E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 2.72E-07 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434765214 NA 1.81E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251