\
| Variant ID: vg0434743189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34743189 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.13, others allele: 0.00, population size: 94. )
ATCTCTAAACTTGGTTTAATGTATCATCCCGGTCCAAAGCCTCATTTGACTGTGGTCTTACCTACATAGCATGCCACGTGGACGATGACATTGACAGCCT[A/G]
TCAGGGCCTCACTACTCTCCCCTCCTCTCTATCCTCTCTCTTCGGCCGGTTGAGTGGGACGGGCGGCCGGCGACCGAAGCGGGCGACTGGCGTGTCGGAG
CTCCGACACGCCAGTCGCCCGCTTCGGTCGCCGGCCGCCCGTCCCACTCAACCGGCCGAAGAGAGAGGATAGAGAGGAGGGGAGAGTAGTGAGGCCCTGA[T/C]
AGGCTGTCAATGTCATCGTCCACGTGGCATGCTATGTAGGTAAGACCACAGTCAAATGAGGCTTTGGACCGGGATGATACATTAAACCAAGTTTAGAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 31.90% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 13.00% | 86.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 1.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 4.60% | 95.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 8.10% | 91.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434743189 | A -> G | LOC_Os04g58390.1 | downstream_gene_variant ; 470.0bp to feature; MODIFIER | silent_mutation | Average:76.016; most accessible tissue: Callus, score: 89.597 | N | N | N | N |
| vg0434743189 | A -> G | LOC_Os04g58400.1 | downstream_gene_variant ; 283.0bp to feature; MODIFIER | silent_mutation | Average:76.016; most accessible tissue: Callus, score: 89.597 | N | N | N | N |
| vg0434743189 | A -> G | LOC_Os04g58390-LOC_Os04g58400 | intergenic_region ; MODIFIER | silent_mutation | Average:76.016; most accessible tissue: Callus, score: 89.597 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434743189 | NA | 2.51E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 1.12E-12 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 2.47E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 2.47E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 8.09E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 1.80E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 9.81E-08 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 7.08E-15 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 3.90E-10 | mr1349_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 4.69E-25 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 2.82E-45 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 1.39E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 2.40E-06 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434743189 | NA | 5.69E-06 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |