\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434743189:

Variant ID: vg0434743189 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34743189
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.13, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCTAAACTTGGTTTAATGTATCATCCCGGTCCAAAGCCTCATTTGACTGTGGTCTTACCTACATAGCATGCCACGTGGACGATGACATTGACAGCCT[A/G]
TCAGGGCCTCACTACTCTCCCCTCCTCTCTATCCTCTCTCTTCGGCCGGTTGAGTGGGACGGGCGGCCGGCGACCGAAGCGGGCGACTGGCGTGTCGGAG

Reverse complement sequence

CTCCGACACGCCAGTCGCCCGCTTCGGTCGCCGGCCGCCCGTCCCACTCAACCGGCCGAAGAGAGAGGATAGAGAGGAGGGGAGAGTAGTGAGGCCCTGA[T/C]
AGGCTGTCAATGTCATCGTCCACGTGGCATGCTATGTAGGTAAGACCACAGTCAAATGAGGCTTTGGACCGGGATGATACATTAAACCAAGTTTAGAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 31.90% 0.19% 0.00% NA
All Indica  2759 97.80% 2.00% 0.25% 0.00% NA
All Japonica  1512 13.00% 86.90% 0.07% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 96.30% 3.20% 0.51% 0.00% NA
Temperate Japonica  767 4.60% 95.30% 0.13% 0.00% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.80% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434743189 A -> G LOC_Os04g58390.1 downstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:76.016; most accessible tissue: Callus, score: 89.597 N N N N
vg0434743189 A -> G LOC_Os04g58400.1 downstream_gene_variant ; 283.0bp to feature; MODIFIER silent_mutation Average:76.016; most accessible tissue: Callus, score: 89.597 N N N N
vg0434743189 A -> G LOC_Os04g58390-LOC_Os04g58400 intergenic_region ; MODIFIER silent_mutation Average:76.016; most accessible tissue: Callus, score: 89.597 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434743189 NA 2.51E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 1.12E-12 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 2.47E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 2.47E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 8.09E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 1.80E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 9.81E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 7.08E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 3.90E-10 mr1349_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 4.69E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 2.82E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 1.39E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 2.40E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434743189 NA 5.69E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251