\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434732193:

Variant ID: vg0434732193 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34732193
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATTTCTATAGAAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAAGTTTAAAATAGTTAATACTCAATTAATCATGCGCTAATGACTCACCT[C/T]
GTTTTGCGTATCTTTTCAATCTTCTCAATCTCCTTCTCCTCAAACTCACCCATAATTTGGCAAGGCATTTTCTTTTTCGGTTACAATGAAATCAAATGAC

Reverse complement sequence

GTCATTTGATTTCATTGTAACCGAAAAAGAAAATGCCTTGCCAAATTATGGGTGAGTTTGAGGAGAAGGAGATTGAGAAGATTGAAAAGATACGCAAAAC[G/A]
AGGTGAGTCATTAGCGCATGATTAATTGAGTATTAACTATTTTAAACTTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTTCTATAGAAATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.40% 0.02% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 14.10% 85.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 29.20% 1.04% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434732193 C -> T LOC_Os04g58370.1 upstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:67.371; most accessible tissue: Callus, score: 79.831 N N N N
vg0434732193 C -> T LOC_Os04g58350.1 downstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:67.371; most accessible tissue: Callus, score: 79.831 N N N N
vg0434732193 C -> T LOC_Os04g58360.1 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:67.371; most accessible tissue: Callus, score: 79.831 N N N N
vg0434732193 C -> T LOC_Os04g58380.1 downstream_gene_variant ; 1403.0bp to feature; MODIFIER silent_mutation Average:67.371; most accessible tissue: Callus, score: 79.831 N N N N
vg0434732193 C -> T LOC_Os04g58360-LOC_Os04g58370 intergenic_region ; MODIFIER silent_mutation Average:67.371; most accessible tissue: Callus, score: 79.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434732193 NA 1.17E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 2.71E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.29E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 2.23E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 4.75E-08 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.30E-18 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.01E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 2.89E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 8.24E-07 NA mr1194 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.44E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.23E-29 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 2.57E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.67E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 5.27E-34 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.88E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 4.26E-13 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.18E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 7.66E-14 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 6.78E-39 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.47E-40 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 5.40E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 7.37E-32 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 7.76E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 8.89E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 6.73E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 5.79E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.80E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.78E-37 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.70E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 5.50E-19 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 9.30E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.96E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 4.69E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.73E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 4.08E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 9.30E-07 3.21E-29 mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.18E-15 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.22E-43 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 8.35E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 2.68E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 5.84E-28 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 3.25E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 5.84E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434732193 NA 1.94E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251