\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434724778:

Variant ID: vg0434724778 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34724778
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGCCGGCCGAAGGGGAGAGAAGAGAAAGGGAAAGAAAGAGAGAAGGGAGGAAGAGCGGAGGAAGAAGAAGAGAGAGGATGGCATGTGGGCCCCACATG[G/T]
CAGTGGGTCCCACACTATATATTTTTTGAATGACAAATGGGCCCCACACTTTTTTTTTTATTTCTAGTGCCACTTAAGCGCCACATCAACGCCACATGGA

Reverse complement sequence

TCCATGTGGCGTTGATGTGGCGCTTAAGTGGCACTAGAAATAAAAAAAAAAGTGTGGGGCCCATTTGTCATTCAAAAAATATATAGTGTGGGACCCACTG[C/A]
CATGTGGGGCCCACATGCCATCCTCTCTCTTCTTCTTCCTCCGCTCTTCCTCCCTTCTCTCTTTCTTTCCCTTTCTCTTCTCTCCCCTTCGGCCGGCCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.80% 0.11% 0.28% NA
All Indica  2759 97.70% 1.70% 0.18% 0.40% NA
All Japonica  1512 13.10% 86.80% 0.00% 0.07% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 98.00% 1.30% 0.00% 0.67% NA
Indica II  465 98.10% 0.90% 0.65% 0.43% NA
Indica III  913 98.60% 1.30% 0.00% 0.11% NA
Indica Intermediate  786 96.20% 3.10% 0.25% 0.51% NA
Temperate Japonica  767 4.60% 95.30% 0.00% 0.13% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434724778 G -> DEL N N silent_mutation Average:99.454; most accessible tissue: Zhenshan97 flag leaf, score: 99.924 N N N N
vg0434724778 G -> T LOC_Os04g58330.1 upstream_gene_variant ; 3528.0bp to feature; MODIFIER silent_mutation Average:99.454; most accessible tissue: Zhenshan97 flag leaf, score: 99.924 N N N N
vg0434724778 G -> T LOC_Os04g58340.1 upstream_gene_variant ; 2.0bp to feature; MODIFIER silent_mutation Average:99.454; most accessible tissue: Zhenshan97 flag leaf, score: 99.924 N N N N
vg0434724778 G -> T LOC_Os04g58350.1 upstream_gene_variant ; 663.0bp to feature; MODIFIER silent_mutation Average:99.454; most accessible tissue: Zhenshan97 flag leaf, score: 99.924 N N N N
vg0434724778 G -> T LOC_Os04g58340-LOC_Os04g58350 intergenic_region ; MODIFIER silent_mutation Average:99.454; most accessible tissue: Zhenshan97 flag leaf, score: 99.924 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434724778 G T -0.03 -0.04 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434724778 NA 7.79E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 7.90E-07 1.44E-21 mr1580 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 2.52E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 1.45E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 9.81E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 1.60E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 3.00E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 3.74E-48 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 1.39E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 2.40E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434724778 NA 5.69E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251