\
| Variant ID: vg0434702618 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34702618 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, C: 0.09, others allele: 0.00, population size: 268. )
CGTTATTGGTACATTGACTTTCGCCAAGCACCCCCCATGTGCGCAAATAAGAAAGTGATGGTTTTCTCCCAATCCATATCTCATATGGTGTTTTGTCCTT[C/A]
TTTCTGTTAGGAACTCTGTTTAACACATGATTCGAGGTCAACAATGCCTCCCCCCACCATGCCTTAGGTAGTCCCGCGGTGTCTAACATGGCATTCACCA
TGGTGAATGCCATGTTAGACACCGCGGGACTACCTAAGGCATGGTGGGGGGAGGCATTGTTGACCTCGAATCATGTGTTAAACAGAGTTCCTAACAGAAA[G/T]
AAGGACAAAACACCATATGAGATATGGATTGGGAGAAAACCATCACTTTCTTATTTGCGCACATGGGGGGTGCTTGGCGAAAGTCAATGTACCAATAACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 32.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.60% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 13.20% | 86.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 6.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.10% | 91.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 64.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434702618 | C -> A | LOC_Os04g58300.1 | missense_variant ; p.Lys438Asn; MODERATE | nonsynonymous_codon ; K438N | Average:24.11; most accessible tissue: Minghui63 panicle, score: 34.226 | benign |
-0.277 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434702618 | 8.03E-06 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | 3.04E-06 | NA | mr1009 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 1.75E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 3.81E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 6.07E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 7.54E-07 | mr1534 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 1.22E-10 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 7.34E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 9.03E-06 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 6.28E-14 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 7.59E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 4.13E-44 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 8.88E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 2.29E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434702618 | NA | 6.43E-06 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |