\
| Variant ID: vg0434701142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34701142 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )
TATCCACTAGTGGCTTTGATCTCATCCACATCAGAGATCCAGTTAGAATCACTATATTCCTCCAGTATCGCAGGATACCCAGTATAGTGAAGCCCCAATT[C/A]
CATAGTACGTTTTAGATAGCGCATTACTCGCTCGAGCGCACGCCAGTGATCATCTCTTGGATTAGAGGTAAACCGGCTCAACTTGCTCACAGCAAAGGAG
CTCCTTTGCTGTGAGCAAGTTGAGCCGGTTTACCTCTAATCCAAGAGATGATCACTGGCGTGCGCTCGAGCGAGTAATGCGCTATCTAAAACGTACTATG[G/T]
AATTGGGGCTTCACTATACTGGGTATCCTGCGATACTGGAGGAATATAGTGATTCTAACTGGATCTCTGATGTGGATGAGATCAAAGCCACTAGTGGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 48.00% | 1.69% | 0.23% | NA |
| All Indica | 2759 | 84.00% | 12.90% | 2.75% | 0.36% | NA |
| All Japonica | 1512 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.10% | 5.70% | 3.19% | 1.01% | NA |
| Indica II | 465 | 86.20% | 9.70% | 4.09% | 0.00% | NA |
| Indica III | 913 | 82.10% | 15.10% | 2.63% | 0.11% | NA |
| Indica Intermediate | 786 | 80.20% | 17.70% | 1.78% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 64.40% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434701142 | C -> DEL | LOC_Os04g58290.1 | N | frameshift_variant | Average:27.758; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| vg0434701142 | C -> A | LOC_Os04g58290.1 | stop_gained ; p.Glu320*; HIGH | stop_gained | Average:27.758; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434701142 | NA | 1.31E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 3.93E-21 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 2.03E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | 6.18E-06 | NA | mr1322_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 9.76E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 2.01E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 6.46E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 1.48E-12 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 4.40E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 3.66E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 2.84E-21 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434701142 | NA | 7.32E-27 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |