Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434660067:

Variant ID: vg0434660067 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34660067
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, A: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAAAAAATTATAAAAAAAATTAAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTATCATTTAACAAGAATAAAAATACGAATTATAAAAAAA[T/A]
TTTATATAAGACGGACAGTCAAAGTTGAACATGGAAACCCAGGGTTTGCCTTTTCTTGGGACGGAGGGAGTATATCTTTTATATTTTTTGAAAAATAAAT

Reverse complement sequence

ATTTATTTTTCAAAAAATATAAAAGATATACTCCCTCCGTCCCAAGAAAAGGCAAACCCTGGGTTTCCATGTTCAACTTTGACTGTCCGTCTTATATAAA[A/T]
TTTTTTTATAATTCGTATTTTTATTCTTGTTAAATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTTATAATTTTTTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	41.80%	3.05%	4.23%	NA
All Indica	2759	84.10%	5.20%	4.35%	6.34%	NA
All Japonica	1512	2.90%	94.40%	1.32%	1.39%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	86.90%	2.00%	6.72%	4.37%	NA
Indica II	465	80.90%	3.00%	4.73%	11.40%	NA
Indica III	913	91.10%	3.20%	1.86%	3.83%	NA
Indica Intermediate	786	75.80%	11.20%	5.22%	7.76%	NA
Temperate Japonica	767	0.40%	95.80%	1.43%	2.35%	NA
Tropical Japonica	504	7.10%	90.90%	1.79%	0.20%	NA
Japonica Intermediate	241	2.10%	97.10%	0.00%	0.83%	NA
VI/Aromatic	96	4.20%	93.80%	1.04%	1.04%	NA
Intermediate	90	37.80%	55.60%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434660067	T -> DEL	N	N	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58190.1	upstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58200.1	upstream_gene_variant ; 2988.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58210.1	upstream_gene_variant ; 4869.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58190.2	upstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58190.3	upstream_gene_variant ; 3332.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58200.3	upstream_gene_variant ; 2989.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58200.2	upstream_gene_variant ; 2992.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58180.1	downstream_gene_variant ; 4851.0bp to feature; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg0434660067	T -> A	LOC_Os04g58190-LOC_Os04g58200	intergenic_region ; MODIFIER	silent_mutation	Average:56.32; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434660067	NA	5.28E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.29E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	7.78E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.77E-48	mr1121	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	4.98E-55	mr1125	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	4.35E-43	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	8.76E-26	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	4.07E-29	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	6.06E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.03E-27	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	6.17E-44	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.27E-24	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	5.53E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	2.84E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	5.53E-31	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	7.09E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	3.89E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.24E-38	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	6.43E-52	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.06E-68	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.88E-23	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	1.22E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	4.26E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	7.45E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	4.47E-27	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	3.71E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	3.29E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	4.94E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	8.50E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	8.76E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	6.28E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	5.29E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	9.65E-23	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	3.93E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067	NA	8.04E-28	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251