\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434660067:

Variant ID: vg0434660067 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34660067
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, A: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAAAAAATTATAAAAAAAATTAAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTATCATTTAACAAGAATAAAAATACGAATTATAAAAAAA[T/A]
TTTATATAAGACGGACAGTCAAAGTTGAACATGGAAACCCAGGGTTTGCCTTTTCTTGGGACGGAGGGAGTATATCTTTTATATTTTTTGAAAAATAAAT

Reverse complement sequence

ATTTATTTTTCAAAAAATATAAAAGATATACTCCCTCCGTCCCAAGAAAAGGCAAACCCTGGGTTTCCATGTTCAACTTTGACTGTCCGTCTTATATAAA[A/T]
TTTTTTTATAATTCGTATTTTTATTCTTGTTAAATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTTATAATTTTTTCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 41.80% 3.05% 4.23% NA
All Indica  2759 84.10% 5.20% 4.35% 6.34% NA
All Japonica  1512 2.90% 94.40% 1.32% 1.39% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 86.90% 2.00% 6.72% 4.37% NA
Indica II  465 80.90% 3.00% 4.73% 11.40% NA
Indica III  913 91.10% 3.20% 1.86% 3.83% NA
Indica Intermediate  786 75.80% 11.20% 5.22% 7.76% NA
Temperate Japonica  767 0.40% 95.80% 1.43% 2.35% NA
Tropical Japonica  504 7.10% 90.90% 1.79% 0.20% NA
Japonica Intermediate  241 2.10% 97.10% 0.00% 0.83% NA
VI/Aromatic  96 4.20% 93.80% 1.04% 1.04% NA
Intermediate  90 37.80% 55.60% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434660067 T -> DEL N N silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58190.1 upstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58200.1 upstream_gene_variant ; 2988.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58210.1 upstream_gene_variant ; 4869.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58190.2 upstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58190.3 upstream_gene_variant ; 3332.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58200.3 upstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58200.2 upstream_gene_variant ; 2992.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58180.1 downstream_gene_variant ; 4851.0bp to feature; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0434660067 T -> A LOC_Os04g58190-LOC_Os04g58200 intergenic_region ; MODIFIER silent_mutation Average:56.32; most accessible tissue: Minghui63 root, score: 85.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434660067 NA 5.28E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.29E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 7.78E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.77E-48 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 4.98E-55 mr1125 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 4.35E-43 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 8.76E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 4.07E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 6.06E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.03E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 6.17E-44 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.27E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 5.53E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 2.84E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 5.53E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 7.09E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 3.89E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.24E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 6.43E-52 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.06E-68 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.88E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 1.22E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 4.26E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 7.45E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 4.47E-27 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 3.71E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 3.29E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 4.94E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 8.50E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 8.76E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 6.28E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 5.29E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 9.65E-23 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 3.93E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434660067 NA 8.04E-28 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251