\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434580936:

Variant ID: vg0434580936 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34580936
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTAGATTATTAGAGTCTAGATTATTGGGTTTGCAAGTCTAAAGAGGAAGTGGGGTGGCATGGTGGGTAATTTTTCACTCAATAATCTAAAAAAAAAGTT[C/T]
ACCTAAATGAGCTTATCAGATTATAATAAGCTGAGCTTCAAATTATAATAAACTAATTTAATAAGTTATCTGTTTCTTTTAGATTACTCATGATAATCTG

Reverse complement sequence

CAGATTATCATGAGTAATCTAAAAGAAACAGATAACTTATTAAATTAGTTTATTATAATTTGAAGCTCAGCTTATTATAATCTGATAAGCTCATTTAGGT[G/A]
AACTTTTTTTTTAGATTATTGAGTGAAAAATTACCCACCATGCCACCCCACTTCCTCTTTAGACTTGCAAACCCAATAATCTAGACTCTAATAATCTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 1.20% 0.76% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.20% 3.50% 2.25% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 92.20% 4.20% 3.65% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 90.50% 7.90% 1.66% 0.00% NA
VI/Aromatic  96 92.70% 5.20% 2.08% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434580936 C -> T LOC_Os04g58055.1 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:73.784; most accessible tissue: Callus, score: 92.74 N N N N
vg0434580936 C -> T LOC_Os04g58060.1 upstream_gene_variant ; 135.0bp to feature; MODIFIER silent_mutation Average:73.784; most accessible tissue: Callus, score: 92.74 N N N N
vg0434580936 C -> T LOC_Os04g58060.2 upstream_gene_variant ; 135.0bp to feature; MODIFIER silent_mutation Average:73.784; most accessible tissue: Callus, score: 92.74 N N N N
vg0434580936 C -> T LOC_Os04g58055-LOC_Os04g58060 intergenic_region ; MODIFIER silent_mutation Average:73.784; most accessible tissue: Callus, score: 92.74 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434580936 6.40E-06 4.51E-07 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434580936 6.66E-08 6.66E-08 mr1024_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434580936 NA 9.91E-07 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434580936 1.48E-07 2.98E-10 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434580936 NA 1.71E-06 mr1922_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434580936 6.53E-09 6.53E-09 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251