| Variant ID: vg0434560709 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34560709 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 117. )
CAGTCGGAATTATCCGGAAATTCTCGGATTCGGAAACGAATTCGGATATTTTTTCTTGGAAACGAAAACGAATACAGTAAGGGTAATATCCGTCGGAATC[A/G]
GAAAACGGTCGGAAACTATCCAGAATTTTTTTCAGATATCCGCAGACATTAAGCAAATTATATAAAAAACACGTATATATACATAACTTTTTCATACGGA
TCCGTATGAAAAAGTTATGTATATATACGTGTTTTTTATATAATTTGCTTAATGTCTGCGGATATCTGAAAAAAATTCTGGATAGTTTCCGACCGTTTTC[T/C]
GATTCCGACGGATATTACCCTTACTGTATTCGTTTTCGTTTCCAAGAAAAAATATCCGAATTCGTTTCCGAATCCGAGAATTTCCGGATAATTCCGACTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.10% | 28.70% | 1.23% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 1.70% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 21.50% | 76.50% | 2.05% | 0.00% | NA |
| Aus | 269 | 71.70% | 27.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.00% | 0.80% | 1.18% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.10% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 4.20% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 19.00% | 77.40% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 9.10% | 90.50% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 42.20% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434560709 | A -> G | LOC_Os04g58020.1 | upstream_gene_variant ; 1150.0bp to feature; MODIFIER | silent_mutation | Average:32.024; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0434560709 | A -> G | LOC_Os04g58030.1 | downstream_gene_variant ; 3675.0bp to feature; MODIFIER | silent_mutation | Average:32.024; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0434560709 | A -> G | LOC_Os04g58020-LOC_Os04g58030 | intergenic_region ; MODIFIER | silent_mutation | Average:32.024; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434560709 | NA | 9.70E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 1.27E-11 | mr1118 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 2.34E-08 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 1.10E-06 | mr1239 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 1.86E-08 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 9.03E-09 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 2.37E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 2.11E-10 | mr1495 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 4.02E-10 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434560709 | NA | 1.58E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/