\
| Variant ID: vg0434528001 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34528001 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.10, others allele: 0.00, population size: 76. )
TATATCACTTTTCAATAAATATTTTTATAGAAACAAGAAGTCAAAGTTATGTTTTGGAGACCGTGTCGCTGTTCTAAACGACTTCCTTTACGAGTACAGA[T/G]
GGAGTACTCGACAGTTAAACTTGCTTGAAAAGCTGTTACAGCTTCACCTTGTCTATGCCATGTCTGCTTGCTTAAACTTGACTATGGTTCTGTTCACTTT
AAAGTGAACAGAACCATAGTCAAGTTTAAGCAAGCAGACATGGCATAGACAAGGTGAAGCTGTAACAGCTTTTCAAGCAAGTTTAACTGTCGAGTACTCC[A/C]
TCTGTACTCGTAAAGGAAGTCGTTTAGAACAGCGACACGGTCTCCAAAACATAACTTTGACTTCTTGTTTCTATAAAAATATTTATTGAAAAGTGATATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.30% | 0.34% | 0.30% | NA |
| All Indica | 2759 | 96.40% | 2.80% | 0.36% | 0.47% | NA |
| All Japonica | 1512 | 11.60% | 88.00% | 0.26% | 0.07% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.20% | 0.67% | 0.50% | NA |
| Indica II | 465 | 97.40% | 1.10% | 0.43% | 1.08% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 7.00% | 0.51% | 0.64% | NA |
| Temperate Japonica | 767 | 4.40% | 95.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 6.90% | 92.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 55.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 51.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434528001 | T -> DEL | N | N | silent_mutation | Average:33.096; most accessible tissue: Callus, score: 72.525 | N | N | N | N |
| vg0434528001 | T -> G | LOC_Os04g57950.1 | downstream_gene_variant ; 4422.0bp to feature; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Callus, score: 72.525 | N | N | N | N |
| vg0434528001 | T -> G | LOC_Os04g57950-LOC_Os04g57970 | intergenic_region ; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Callus, score: 72.525 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434528001 | NA | 2.92E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 1.36E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 3.74E-08 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 2.64E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | 1.06E-06 | NA | mr1187_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 7.77E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 5.10E-33 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 4.62E-06 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 1.05E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 2.96E-29 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 1.54E-08 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 1.04E-22 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434528001 | NA | 2.78E-28 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |