\
| Variant ID: vg0434493414 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34493414 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 350. )
TAAAACCAATAACATCGATTTATTAAAATTTGCTCTAGATTCAGTGGATAAACTTACTTGTTAATGTCATCTGAAGAATAACCAGTAACACCACCAAATA[C/T]
GACAAGCACATAATTCACATCCAGTGACTGCATTATCTCATACGCTTCATCTTCATAGGATGACATTGCACGCCCAACTGTAGCTATATGTGTATTATTC
GAATAATACACATATAGCTACAGTTGGGCGTGCAATGTCATCCTATGAAGATGAAGCGTATGAGATAATGCAGTCACTGGATGTGAATTATGTGCTTGTC[G/A]
TATTTGGTGGTGTTACTGGTTATTCTTCAGATGACATTAACAAGTAAGTTTATCCACTGAATCTAGAGCAAATTTTAATAAATCGATGTTATTGGTTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 16.90% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 53.20% | 44.10% | 2.65% | 0.00% | NA |
| Aus | 269 | 74.00% | 25.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.30% | 21.60% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 12.50% | 86.50% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 27.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 24.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434493414 | C -> T | LOC_Os04g57890.1 | missense_variant ; p.Val604Ile; MODERATE | nonsynonymous_codon ; V604I | Average:46.727; most accessible tissue: Minghui63 flower, score: 56.663 | benign |
0.877 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434493414 | NA | 1.67E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.64E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.09E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.47E-07 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 5.66E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 9.39E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.27E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.81E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | 3.55E-06 | 1.80E-22 | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 5.30E-08 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 6.66E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 9.26E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.76E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 4.54E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434493414 | NA | 1.90E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |