Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0434433822:

Variant ID: vg0434433822 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34433822
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATAAAATTTTATAACAAATACTTCTTCCGTCATATAATATAAAGGATTTTGAGTGGATGCGACACATCCTACTGTAATGAATGTACTCGTCTGTACAG[A/G]
TTCATGGTATTAGGATGCGTCGCATCCACATAAAATCCCTTATATTATAGAACGAAATGAGTACTAATGATATTGAAGTTTGTCTGGACTAAAAAAAATC

Reverse complement sequence

GATTTTTTTTAGTCCAGACAAACTTCAATATCATTAGTACTCATTTCGTTCTATAATATAAGGGATTTTATGTGGATGCGACGCATCCTAATACCATGAA[T/C]
CTGTACAGACGAGTACATTCATTACAGTAGGATGTGTCGCATCCACTCAAAATCCTTTATATTATATGACGGAAGAAGTATTTGTTATAAAATTTTATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 6.00% 4.40% 0.00% NA
All Indica  2759 82.50% 10.20% 7.36% 0.00% NA
All Japonica  1512 99.70% 0.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 55.60% 24.90% 19.50% 0.00% NA
Indica II  465 88.00% 7.70% 4.30% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 79.50% 12.00% 8.52% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434433822 A -> G LOC_Os04g57830.1 upstream_gene_variant ; 2836.0bp to feature; MODIFIER silent_mutation Average:80.076; most accessible tissue: Callus, score: 92.594 N N N N
vg0434433822 A -> G LOC_Os04g57819.2 downstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:80.076; most accessible tissue: Callus, score: 92.594 N N N N
vg0434433822 A -> G LOC_Os04g57819.1 downstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:80.076; most accessible tissue: Callus, score: 92.594 N N N N
vg0434433822 A -> G LOC_Os04g57819-LOC_Os04g57830 intergenic_region ; MODIFIER silent_mutation Average:80.076; most accessible tissue: Callus, score: 92.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434433822 A G 0.02 0.0 -0.01 -0.02 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434433822 NA 4.71E-12 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0434433822 NA 1.51E-10 Spikelet_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0434433822 NA 8.01E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 8.46E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 1.64E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 9.09E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 2.16E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 1.45E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 3.70E-07 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 1.40E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 3.18E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433822 NA 6.99E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251