Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434406763:

Variant ID: vg0434406763 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34406763
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GACTGCAGCAACCGTCATTCTGTGACCTATCATGCAAATGAATTGGTCATGATAGTGTAAAGTAACAGAAACGTTGAACACTGGGGCGAAAGTTCCCCAC[A/C]
TAGGCTCGTGTCGCTCCAGCCCCAGGGGCGATGCGAGCGCCCCCACACGCGCCGGCCGCCGCCGCGCCTTCCCCCTCCCCTTCGCCTCGCCGCCGCCCGA

Reverse complement sequence

TCGGGCGGCGGCGAGGCGAAGGGGAGGGGGAAGGCGCGGCGGCGGCCGGCGCGTGTGGGGGCGCTCGCATCGCCCCTGGGGCTGGAGCGACACGAGCCTA[T/G]
GTGGGGAACTTTCGCCCCAGTGTTCAACGTTTCTGTTACTTTACACTATCATGACCAATTCATTTGCATGATAGGTCACAGAATGACGGTTGCTGCAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.60% 0.13% 0.02% NA
All Indica  2759 93.90% 5.90% 0.14% 0.04% NA
All Japonica  1512 1.40% 98.60% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 91.60% 8.10% 0.34% 0.00% NA
Indica II  465 96.30% 3.20% 0.22% 0.22% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.80% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434406763 A -> C LOC_Os04g57770.1 5_prime_UTR_variant ; 31.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Zhenshan97 flower, score: 97.892 N N N N
vg0434406763 A -> C LOC_Os04g57780.1 downstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Zhenshan97 flower, score: 97.892 N N N N
vg0434406763 A -> C LOC_Os04g57780.2 downstream_gene_variant ; 4468.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Zhenshan97 flower, score: 97.892 N N N N
vg0434406763 A -> DEL N N silent_mutation Average:96.053; most accessible tissue: Zhenshan97 flower, score: 97.892 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434406763 A C -0.01 0.0 -0.01 -0.01 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434406763 NA 4.61E-51 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.78E-14 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.11E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.58E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 4.42E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.62E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 8.68E-06 mr1977 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.05E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 7.81E-66 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.10E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 4.13E-26 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 4.50E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 3.75E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 5.37E-57 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 4.23E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.03E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 1.81E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434406763 NA 4.47E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251