\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434389908:

Variant ID: vg0434389908 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34389908
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, A: 0.37, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCACGCCAAATCCATTCTATATGTATAATACTAGCACGTCACCGTACGTCGACTTGGAATTTCTTGATAGGCCTGCCATGGTTGGTGGAGTTTTTTT[A/T]
AAAAAAGAAAAATCTCAGAAACCTATTTGTTGAAGCTATTAGTTCGTTGCAAGTTTAGCTCGTTGTTTTAACTTTACTAGTAAAATGTCCGTGCGTTGCA

Reverse complement sequence

TGCAACGCACGGACATTTTACTAGTAAAGTTAAAACAACGAGCTAAACTTGCAACGAACTAATAGCTTCAACAAATAGGTTTCTGAGATTTTTCTTTTTT[T/A]
AAAAAAACTCCACCAACCATGGCAGGCCTATCAAGAAATTCCAAGTCGACGTACGGTGACGTGCTAGTATTATACATATAGAATGGATTTGGCGTGGAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 43.30% 0.32% 0.42% NA
All Indica  2759 93.50% 5.50% 0.43% 0.54% NA
All Japonica  1512 1.30% 98.30% 0.07% 0.26% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 95.10% 2.90% 1.51% 0.50% NA
Indica II  465 95.90% 2.80% 0.22% 1.08% NA
Indica III  913 93.40% 6.60% 0.00% 0.00% NA
Indica Intermediate  786 91.10% 7.80% 0.25% 0.89% NA
Temperate Japonica  767 0.50% 99.20% 0.00% 0.26% NA
Tropical Japonica  504 2.60% 97.00% 0.20% 0.20% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 41.10% 55.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434389908 A -> DEL N N silent_mutation Average:51.625; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0434389908 A -> T LOC_Os04g57730.1 upstream_gene_variant ; 2011.0bp to feature; MODIFIER silent_mutation Average:51.625; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0434389908 A -> T LOC_Os04g57739.1 upstream_gene_variant ; 3236.0bp to feature; MODIFIER silent_mutation Average:51.625; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0434389908 A -> T LOC_Os04g57739.2 upstream_gene_variant ; 3236.0bp to feature; MODIFIER silent_mutation Average:51.625; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0434389908 A -> T LOC_Os04g57730-LOC_Os04g57739 intergenic_region ; MODIFIER silent_mutation Average:51.625; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434389908 NA 8.24E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.91E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.76E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 5.23E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 9.59E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 6.44E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 5.08E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.35E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.54E-64 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.96E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.83E-15 mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.31E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 5.31E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.48E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.40E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.79E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 7.12E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.80E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 6.83E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.71E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.75E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.00E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 5.73E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 4.52E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.61E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 3.63E-07 3.77E-62 mr1558_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.57E-34 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.33E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.20E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 8.78E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.65E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 5.32E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 3.33E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 9.89E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 5.87E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 1.90E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.62E-24 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 NA 2.63E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434389908 2.17E-06 9.33E-31 mr1943_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251