Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434382078:

Variant ID: vg0434382078 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34382078
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGCTAATGGTTTCAAAGGAAGGGACTGTTTGGCACAGCTTTAGCTCCAGCTTCACCTCTTCTGGAGCTGGAGCTCAGCCAAAAATAGTTTCGGCTCA[A/C]
TCAAAACTAGGAGTGGAGCTGAGTGGAGCTCTCTCACAAAATAAACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCTACTCCAGACTCAACT

Reverse complement sequence

AGTTGAGTCTGGAGTAGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTTTATTTTGTGAGAGAGCTCCACTCAGCTCCACTCCTAGTTTTGA[T/G]
TGAGCCGAAACTATTTTTGGCTGAGCTCCAGCTCCAGAAGAGGTGAAGCTGGAGCTAAAGCTGTGCCAAACAGTCCCTTCCTTTGAAACCATTAGCTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 37.40% 7.98% 0.02% NA
All Indica  2759 23.90% 62.80% 13.30% 0.04% NA
All Japonica  1512 98.90% 0.90% 0.13% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 14.50% 61.20% 24.20% 0.17% NA
Indica II  465 23.00% 63.90% 13.12% 0.00% NA
Indica III  913 30.20% 64.70% 5.04% 0.00% NA
Indica Intermediate  786 24.20% 61.10% 14.76% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 73.30% 18.90% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434382078 A -> C LOC_Os04g57720.1 downstream_gene_variant ; 4721.0bp to feature; MODIFIER silent_mutation Average:86.258; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N
vg0434382078 A -> C LOC_Os04g57730.1 downstream_gene_variant ; 1581.0bp to feature; MODIFIER silent_mutation Average:86.258; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N
vg0434382078 A -> C LOC_Os04g57720-LOC_Os04g57730 intergenic_region ; MODIFIER silent_mutation Average:86.258; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N
vg0434382078 A -> DEL N N silent_mutation Average:86.258; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434382078 A C -0.01 -0.04 -0.04 0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434382078 NA 3.72E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 5.01E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 8.35E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 8.16E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 7.75E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 8.94E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.89E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.48E-41 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.63E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 3.27E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 2.41E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 6.67E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 2.06E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 4.00E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.18E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 1.05E-07 4.96E-08 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 5.71E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.44E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 5.94E-60 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 5.68E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.52E-38 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 3.80E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 2.14E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 3.13E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 1.17E-20 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 7.83E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434382078 NA 2.38E-61 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251