\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434381347:

Variant ID: vg0434381347 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 34381347
Reference Allele: AATAAAGAlternative Allele: GATAAAG,A
Primary Allele: GATAAAGSecondary Allele: AATAAAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACCAAATACTCCAATCCCAGCCCCAGGTCATGCAAAACGGCAGGCAGCCATCCACATTCCACCAGGCTACGGTGGTGTTCTTTTCTCTTAAAAATAAA[AATAAAG/GATAAAG,A]
ATCAATCTACTTATGTAAAATAAGTTGGTATTAACGTATAATTAATTAAGTTTTAATTATTATAAACTTAAAAAGTATATTCATATGATATTTTAGAATA

Reverse complement sequence

TATTCTAAAATATCATATGAATATACTTTTTAAGTTTATAATAATTAAAACTTAATTAATTATACGTTAATACCAACTTATTTTACATAAGTAGATTGAT[CTTTATT/CTTTATC,T]
TTTATTTTTAAGAGAAAAGAACACCACCGTAGCCTGGTGGAATGTGGATGGCTGCCTGCCGTTTTGCATGACCTGGGGCTGGGATTGGAGTATTTGGTTC

Allele Frequencies:

Populations Population SizeFrequency of GATAAAG(primary allele) Frequency of AATAAAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 43.40% 0.23% 0.49% A: 0.02%
All Indica  2759 93.30% 5.80% 0.25% 0.62% NA
All Japonica  1512 1.50% 98.30% 0.00% 0.26% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 98.00% 1.20% 0.34% 0.50% NA
Indica II  465 95.50% 3.00% 0.22% 1.29% NA
Indica III  913 91.60% 8.10% 0.33% 0.00% NA
Indica Intermediate  786 90.60% 8.30% 0.13% 1.02% NA
Temperate Japonica  767 0.80% 99.10% 0.00% 0.13% NA
Tropical Japonica  504 2.60% 97.00% 0.00% 0.40% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 38.90% 53.30% 4.44% 2.22% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434381347 AATAAAG -> GATAAAG LOC_Os04g57720.1 downstream_gene_variant ; 3990.0bp to feature; MODIFIER silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0434381347 AATAAAG -> GATAAAG LOC_Os04g57730.1 downstream_gene_variant ; 2312.0bp to feature; MODIFIER silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0434381347 AATAAAG -> GATAAAG LOC_Os04g57720-LOC_Os04g57730 intergenic_region ; MODIFIER silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0434381347 AATAAAG -> DEL N N silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0434381347 AATAAAG -> A LOC_Os04g57720.1 downstream_gene_variant ; 3991.0bp to feature; MODIFIER silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0434381347 AATAAAG -> A LOC_Os04g57730.1 downstream_gene_variant ; 2311.0bp to feature; MODIFIER silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0434381347 AATAAAG -> A LOC_Os04g57720-LOC_Os04g57730 intergenic_region ; MODIFIER silent_mutation Average:87.766; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434381347 AATAA* A 0.02 -0.1 -0.11 0.06 0.04 0.17
vg0434381347 AATAA* GATAA* -0.05 -0.04 -0.04 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434381347 NA 8.84E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 5.00E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 1.81E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 1.11E-42 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 5.78E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 3.52E-52 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 6.28E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 8.33E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 2.99E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 1.61E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 3.33E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 9.50E-35 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 4.47E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 1.26E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 6.57E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 7.66E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 2.13E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 1.01E-20 mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 4.32E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 1.64E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434381347 NA 7.76E-28 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251