Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434378375:

Variant ID: vg0434378375 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34378375
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGGAAAAATGTATAAGGGCAAGTATAAGCCTCTGCATGTTGCCCCTAAATTTACCACATAAGGCACTGTTTAGATTCTCTAAAATAGTAAAAGTTTT[G/A]
TCATTTTATAGCACTTTTTGCCATTTTGGATCTAAACACTAGTAGCAAAAGTTGGCAATTTGGTATTTGGCATTTGCTAGTACATAGTAGCAAATTGTGC

Reverse complement sequence

GCACAATTTGCTACTATGTACTAGCAAATGCCAAATACCAAATTGCCAACTTTTGCTACTAGTGTTTAGATCCAAAATGGCAAAAAGTGCTATAAAATGA[C/T]
AAAACTTTTACTATTTTAGAGAATCTAAACAGTGCCTTATGTGGTAAATTTAGGGGCAACATGCAGAGGCTTATACTTGCCCTTATACATTTTTCCATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 42.80% 0.06% 0.61% NA
All Indica  2759 94.40% 4.70% 0.07% 0.80% NA
All Japonica  1512 1.40% 98.30% 0.00% 0.33% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 98.00% 1.20% 0.00% 0.84% NA
Indica II  465 96.10% 2.20% 0.00% 1.72% NA
Indica III  913 93.40% 6.40% 0.22% 0.00% NA
Indica Intermediate  786 91.90% 7.00% 0.00% 1.15% NA
Temperate Japonica  767 0.70% 99.10% 0.00% 0.26% NA
Tropical Japonica  504 2.60% 97.00% 0.00% 0.40% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 41.10% 55.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434378375 G -> DEL N N silent_mutation Average:78.663; most accessible tissue: Minghui63 flower, score: 94.182 N N N N
vg0434378375 G -> A LOC_Os04g57720.1 downstream_gene_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:78.663; most accessible tissue: Minghui63 flower, score: 94.182 N N N N
vg0434378375 G -> A LOC_Os04g57720-LOC_Os04g57730 intergenic_region ; MODIFIER silent_mutation Average:78.663; most accessible tissue: Minghui63 flower, score: 94.182 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434378375 G A 0.0 -0.01 0.0 -0.02 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434378375 NA 8.86E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 1.93E-52 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 7.09E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 5.65E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 1.99E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 4.17E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 3.39E-65 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 2.86E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 5.09E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 7.19E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 1.31E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 2.03E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 7.09E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 4.35E-58 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 5.98E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 3.94E-06 NA mr1667_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 7.41E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 1.16E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434378375 NA 1.65E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251