Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434375566:

Variant ID: vg0434375566 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34375566
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.19, T: 0.03, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGGAGAGAGAGGGGCAGGAACGGCTTCTTTGGTTTGAAGCCAATTTTGACCTTACCAAAAATTTTGGTAGTGCTAAAATCAAATCTTGACAAGTTTTG[A/G]
CACTATCAAATTAAATGCTATTGAGTTTAAACTATTGTGTCAAAAAATTGATAGCAAACTAAATATACATTTGTTACTATTGAACCTACCATGAATTTGG

Reverse complement sequence

CCAAATTCATGGTAGGTTCAATAGTAACAAATGTATATTTAGTTTGCTATCAATTTTTTGACACAATAGTTTAAACTCAATAGCATTTAATTTGATAGTG[T/C]
CAAAACTTGTCAAGATTTGATTTTAGCACTACCAAAATTTTTGGTAAGGTCAAAATTGGCTTCAAACCAAAGAAGCCGTTCCTGCCCCTCTCTCTCCCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	25.90%	0.25%	0.00%	NA
All Indica	2759	96.70%	3.30%	0.04%	0.00%	NA
All Japonica	1512	31.50%	67.90%	0.60%	0.00%	NA
Aus	269	73.60%	25.70%	0.74%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	94.60%	5.30%	0.11%	0.00%	NA
Indica Intermediate	786	96.30%	3.70%	0.00%	0.00%	NA
Temperate Japonica	767	8.20%	91.10%	0.65%	0.00%	NA
Tropical Japonica	504	75.00%	24.40%	0.60%	0.00%	NA
Japonica Intermediate	241	14.50%	85.10%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434375566	A -> G	LOC_Os04g57720.1	upstream_gene_variant ; 412.0bp to feature; MODIFIER	silent_mutation	Average:99.332; most accessible tissue: Zhenshan97 flag leaf, score: 99.649	N	N	N	N
vg0434375566	A -> G	LOC_Os04g57710-LOC_Os04g57720	intergenic_region ; MODIFIER	silent_mutation	Average:99.332; most accessible tissue: Zhenshan97 flag leaf, score: 99.649	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0434375566	A	G	0.01	0.02	0.01	0.03	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434375566	NA	3.57E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	2.14E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	6.95E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	7.19E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	2.22E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	9.31E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	2.67E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	5.45E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	1.13E-07	mr1942	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	6.54E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	1.56E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	2.77E-08	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	1.29E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434375566	NA	1.69E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251