\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434271661:

Variant ID: vg0434271661 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34271661
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAAGACTAGAGAAAAAAATAAGCTCGCGCGTTACAACGGGTGAAGGTTATTTTAATTTAGAGTAAAGTGCATTGGCAGTCCTTAAACTCGTAAGGTT[A/G]
TGTTATAAAGGTCTCTAAAATCTCAAAATACATATCCAGGTCCCATAACTTGTCAAAGTGTATCATCTATGTCCCAAATTGATACATCCCCTCTAGAATC

Reverse complement sequence

GATTCTAGAGGGGATGTATCAATTTGGGACATAGATGATACACTTTGACAAGTTATGGGACCTGGATATGTATTTTGAGATTTTAGAGACCTTTATAACA[T/C]
AACCTTACGAGTTTAAGGACTGCCAATGCACTTTACTCTAAATTAAAATAACCTTCACCCGTTGTAACGCGCGAGCTTATTTTTTTCTCTAGTCTTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.20% 0.04% 0.57% NA
All Indica  2759 88.80% 10.40% 0.04% 0.69% NA
All Japonica  1512 1.40% 98.30% 0.07% 0.20% NA
Aus  269 0.70% 98.90% 0.00% 0.37% NA
Indica I  595 98.20% 1.70% 0.00% 0.17% NA
Indica II  465 94.80% 4.30% 0.00% 0.86% NA
Indica III  913 79.20% 20.00% 0.11% 0.66% NA
Indica Intermediate  786 89.40% 9.50% 0.00% 1.02% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 96.40% 0.20% 0.40% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 37.80% 57.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434271661 A -> DEL N N silent_mutation Average:58.034; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0434271661 A -> G LOC_Os04g57590.1 upstream_gene_variant ; 813.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0434271661 A -> G LOC_Os04g57590.3 upstream_gene_variant ; 1968.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0434271661 A -> G LOC_Os04g57590.2 upstream_gene_variant ; 946.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0434271661 A -> G LOC_Os04g57600.1 downstream_gene_variant ; 986.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0434271661 A -> G LOC_Os04g57590-LOC_Os04g57600 intergenic_region ; MODIFIER silent_mutation Average:58.034; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434271661 7.89E-12 3.03E-10 Awn_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0434271661 NA 1.60E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 2.04E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 2.21E-51 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.74E-49 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 7.69E-55 mr1125 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 5.42E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.72E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.56E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 9.20E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 7.74E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.99E-42 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 7.94E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.17E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.31E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 4.19E-53 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 4.60E-62 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 8.16E-66 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 2.97E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 2.39E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 3.21E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 2.82E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 8.83E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 7.33E-36 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 5.71E-30 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 7.97E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 8.12E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 2.35E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434271661 NA 1.13E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251