Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434013322:

Variant ID: vg0434013322 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34013322
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGCCAAGAATCACATGCTCTGATACCATTTGTCAAGCCCCGGCCAGATTCAGAGCTTGACAAGAACAATTTCAGAGAAAAGAGGCTTAAGTAGCTATC[C/A]
TAATGGGATTAAATTGAAGGATTTGCACTGAATTGAAGAGTACACAGTACAAGGAAATAGATGGGCGCCGCAAGACAAGAGTAAAGTAAATTAGGGTTCA

Reverse complement sequence

TGAACCCTAATTTACTTTACTCTTGTCTTGCGGCGCCCATCTATTTCCTTGTACTGTGTACTCTTCAATTCAGTGCAAATCCTTCAATTTAATCCCATTA[G/T]
GATAGCTACTTAAGCCTCTTTTCTCTGAAATTGTTCTTGTCAAGCTCTGAATCTGGCCGGGGCTTGACAAATGGTATCAGAGCATGTGATTCTTGGCCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.40%	13.40%	1.44%	65.68%	NA
All Indica	2759	4.00%	22.40%	1.70%	71.91%	NA
All Japonica	1512	40.40%	0.40%	0.73%	58.47%	NA
Aus	269	57.60%	0.40%	3.35%	38.66%	NA
Indica I	595	1.00%	6.60%	2.69%	89.75%	NA
Indica II	465	1.10%	38.70%	1.72%	58.49%	NA
Indica III	913	5.50%	22.50%	1.10%	70.97%	NA
Indica Intermediate	786	6.40%	24.60%	1.65%	67.43%	NA
Temperate Japonica	767	72.20%	0.00%	0.52%	27.25%	NA
Tropical Japonica	504	3.60%	0.80%	0.79%	94.84%	NA
Japonica Intermediate	241	16.20%	0.80%	1.24%	81.74%	NA
VI/Aromatic	96	15.60%	1.00%	0.00%	83.33%	NA
Intermediate	90	30.00%	11.10%	1.11%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434013322	C -> DEL	N	N	silent_mutation	Average:7.697; most accessible tissue: Callus, score: 34.2	N	N	N	N
vg0434013322	C -> A	LOC_Os04g57060.1	upstream_gene_variant ; 274.0bp to feature; MODIFIER	silent_mutation	Average:7.697; most accessible tissue: Callus, score: 34.2	N	N	N	N
vg0434013322	C -> A	LOC_Os04g57070.1	upstream_gene_variant ; 768.0bp to feature; MODIFIER	silent_mutation	Average:7.697; most accessible tissue: Callus, score: 34.2	N	N	N	N
vg0434013322	C -> A	LOC_Os04g57080.1	upstream_gene_variant ; 4103.0bp to feature; MODIFIER	silent_mutation	Average:7.697; most accessible tissue: Callus, score: 34.2	N	N	N	N
vg0434013322	C -> A	LOC_Os04g57060-LOC_Os04g57070	intergenic_region ; MODIFIER	silent_mutation	Average:7.697; most accessible tissue: Callus, score: 34.2	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434013322	NA	4.35E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	2.85E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	1.44E-06	mr1311	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	2.12E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	1.96E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	4.65E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	2.48E-06	mr1603	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	4.62E-06	NA	mr1964	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434013322	NA	9.78E-06	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251