\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433948721:

Variant ID: vg0433948721 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33948721
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATCCGAGGCCATTATATAAGATTTCCATAGACTAGTAAGCACTATTGACTTGATCTACACTTCCTTTCTCCTCAGGTATAACCAATTGTTTGCACC[G/A]
TAGAAGTAGATATTTACAGTAGTCAGTTATTGAACCCATTACGAACTCACCATAAAATTATTGCCTCTAGGTGGCCTGAATATTTTGTCATCTTATGCCT

Reverse complement sequence

AGGCATAAGATGACAAAATATTCAGGCCACCTAGAGGCAATAATTTTATGGTGAGTTCGTAATGGGTTCAATAACTGACTACTGTAAATATCTACTTCTA[C/T]
GGTGCAAACAATTGGTTATACCTGAGGAGAAAGGAAGTGTAGATCAAGTCAATAGTGCTTACTAGTCTATGGAAATCTTATATAATGGCCTCGGATTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 5.60% 0.08% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 82.60% 17.10% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 69.50% 30.10% 0.39% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433948721 G -> A LOC_Os04g56930.1 upstream_gene_variant ; 2201.0bp to feature; MODIFIER silent_mutation Average:53.617; most accessible tissue: Callus, score: 81.268 N N N N
vg0433948721 G -> A LOC_Os04g56960.1 upstream_gene_variant ; 4410.0bp to feature; MODIFIER silent_mutation Average:53.617; most accessible tissue: Callus, score: 81.268 N N N N
vg0433948721 G -> A LOC_Os04g56930.2 upstream_gene_variant ; 2201.0bp to feature; MODIFIER silent_mutation Average:53.617; most accessible tissue: Callus, score: 81.268 N N N N
vg0433948721 G -> A LOC_Os04g56950.1 downstream_gene_variant ; 1500.0bp to feature; MODIFIER silent_mutation Average:53.617; most accessible tissue: Callus, score: 81.268 N N N N
vg0433948721 G -> A LOC_Os04g56939.1 intron_variant ; MODIFIER silent_mutation Average:53.617; most accessible tissue: Callus, score: 81.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433948721 1.67E-07 NA mr1010_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433948721 6.74E-07 NA mr1010_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433948721 5.38E-07 NA mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433948721 5.89E-07 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433948721 NA 9.81E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251