\
| Variant ID: vg0433948721 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 33948721 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 281. )
AAAAATCCGAGGCCATTATATAAGATTTCCATAGACTAGTAAGCACTATTGACTTGATCTACACTTCCTTTCTCCTCAGGTATAACCAATTGTTTGCACC[G/A]
TAGAAGTAGATATTTACAGTAGTCAGTTATTGAACCCATTACGAACTCACCATAAAATTATTGCCTCTAGGTGGCCTGAATATTTTGTCATCTTATGCCT
AGGCATAAGATGACAAAATATTCAGGCCACCTAGAGGCAATAATTTTATGGTGAGTTCGTAATGGGTTCAATAACTGACTACTGTAAATATCTACTTCTA[C/T]
GGTGCAAACAATTGGTTATACCTGAGGAGAAAGGAAGTGTAGATCAAGTCAATAGTGCTTACTAGTCTATGGAAATCTTATATAATGGCCTCGGATTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.60% | 17.10% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 69.50% | 30.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0433948721 | G -> A | LOC_Os04g56930.1 | upstream_gene_variant ; 2201.0bp to feature; MODIFIER | silent_mutation | Average:53.617; most accessible tissue: Callus, score: 81.268 | N | N | N | N |
| vg0433948721 | G -> A | LOC_Os04g56960.1 | upstream_gene_variant ; 4410.0bp to feature; MODIFIER | silent_mutation | Average:53.617; most accessible tissue: Callus, score: 81.268 | N | N | N | N |
| vg0433948721 | G -> A | LOC_Os04g56930.2 | upstream_gene_variant ; 2201.0bp to feature; MODIFIER | silent_mutation | Average:53.617; most accessible tissue: Callus, score: 81.268 | N | N | N | N |
| vg0433948721 | G -> A | LOC_Os04g56950.1 | downstream_gene_variant ; 1500.0bp to feature; MODIFIER | silent_mutation | Average:53.617; most accessible tissue: Callus, score: 81.268 | N | N | N | N |
| vg0433948721 | G -> A | LOC_Os04g56939.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.617; most accessible tissue: Callus, score: 81.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0433948721 | 1.67E-07 | NA | mr1010_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433948721 | 6.74E-07 | NA | mr1010_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433948721 | 5.38E-07 | NA | mr1013_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433948721 | 5.89E-07 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433948721 | NA | 9.81E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |