RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0433939228:

Variant ID: vg0433939228 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33939228
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAATGGCGGTTGGGGTTGGCCGGCGAGAGGTAGGAGGAGGAGCTGACAGGTGGGACCGCCGGTCCCACCTGTCGGCCGGATGGAGAGAGAGGAAGGAAAC[C/T]
GGGGGACGTAAAGTAGACTTTCGCAAGGCGCGGGCCGGCCGAGAGAGAGAGGAGGCGCGCGGCCTGCGGGAGAGGAGGGGAAGGCTTGGGTCAAGCCCAA

Reverse complement sequence

TTGGGCTTGACCCAAGCCTTCCCCTCCTCTCCCGCAGGCCGCGCGCCTCCTCTCTCTCTCGGCCGGCCCGCGCCTTGCGAAAGTCTACTTTACGTCCCCC[G/A]
GTTTCCTTCCTCTCTCTCCATCCGGCCGACAGGTGGGACCGGCGGTCCCACCTGTCAGCTCCTCCTCCTACCTCTCGCCGGCCAACCCCAACCGCCATTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	23.70%	0.34%	0.00%	NA
All Indica	2759	98.90%	0.90%	0.14%	0.00%	NA
All Japonica	1512	40.30%	59.40%	0.26%	0.00%	NA
Aus	269	52.40%	45.40%	2.23%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	1.80%	0.51%	0.00%	NA
Temperate Japonica	767	43.50%	56.50%	0.00%	0.00%	NA
Tropical Japonica	504	47.80%	51.40%	0.79%	0.00%	NA
Japonica Intermediate	241	14.50%	85.50%	0.00%	0.00%	NA
VI/Aromatic	96	40.60%	57.30%	2.08%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433939228	C -> T	LOC_Os04g56920.1	downstream_gene_variant ; 1701.0bp to feature; MODIFIER	silent_mutation	Average:48.03; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0433939228	C -> T	LOC_Os04g56930.1	downstream_gene_variant ; 4763.0bp to feature; MODIFIER	silent_mutation	Average:48.03; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0433939228	C -> T	LOC_Os04g56930.2	downstream_gene_variant ; 4763.0bp to feature; MODIFIER	silent_mutation	Average:48.03; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0433939228	C -> T	LOC_Os04g56910-LOC_Os04g56920	intergenic_region ; MODIFIER	silent_mutation	Average:48.03; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433939228	2.20E-06	NA	mr1013_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433939228	6.45E-07	NA	mr1031_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0433939228:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact