Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0433820620:

Variant ID: vg0433820620 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33820620
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.26, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTAAAATATTACTTTTGTTAAATAATATCTCACAAAATAAACTCATACATATAATAGTCACATACAATAAATTTATACGCTTCATAAATTTACAATG[C/T]
AGGCGTTCTCGTGGTGCGGTTTTAAGAGAGATGGTATTTCATATAGCCCCAGATGTCATCCTATCTCCAATCTCTTCTCCGCCTTTTTTATCATCTTGAC

Reverse complement sequence

GTCAAGATGATAAAAAAGGCGGAGAAGAGATTGGAGATAGGATGACATCTGGGGCTATATGAAATACCATCTCTCTTAAAACCGCACCACGAGAACGCCT[G/A]
CATTGTAAATTTATGAAGCGTATAAATTTATTGTATGTGACTATTATATGTATGAGTTTATTTTGTGAGATATTATTTAACAAAAGTAATATTTTAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.30%	0.00%	0.00%	NA
All Indica	2759	98.60%	1.40%	0.00%	0.00%	NA
All Japonica	1512	20.80%	79.20%	0.00%	0.00%	NA
Aus	269	60.60%	39.40%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.70%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	56.70%	43.30%	0.00%	0.00%	NA
Japonica Intermediate	241	8.70%	91.30%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433820620	C -> T	LOC_Os04g56710.1	upstream_gene_variant ; 1879.0bp to feature; MODIFIER	silent_mutation	Average:44.507; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0433820620	C -> T	LOC_Os04g56720.1	upstream_gene_variant ; 1791.0bp to feature; MODIFIER	silent_mutation	Average:44.507; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0433820620	C -> T	LOC_Os04g56710-LOC_Os04g56720	intergenic_region ; MODIFIER	silent_mutation	Average:44.507; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433820620	NA	1.16E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	8.04E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	7.15E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.61E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	4.32E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	2.66E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	8.84E-08	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	2.61E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	5.98E-13	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	2.08E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	8.16E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.75E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.76E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	6.39E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.82E-39	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	2.90E-10	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.35E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.20E-43	mr1862_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433820620	NA	1.29E-09	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251