\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433807001:

Variant ID: vg0433807001 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 33807001
Reference Allele: GAlternative Allele: GAGA,GAGATA,A
Primary Allele: GSecondary Allele: GAGA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACAAAGTTTTTAAAAATGATTAAAATGTAAAATATTCACACCGGCGTGCCCTGCAAAATCTTCCTCGCTACCAGCGAGATGACGACTACATCGAGAT[G/GAGA,GAGATA,A]
TACTTGATAGTGCAGTGATAAGTAATATTTAGTTTCAATACTATCTTAACACTCTCGTAATTTAGGGATATATCTCCTTTCAAATCTTGTTTTCTTTTTC

Reverse complement sequence

GAAAAAGAAAACAAGATTTGAAAGGAGATATATCCCTAAATTACGAGAGTGTTAAGATAGTATTGAAACTAAATATTACTTATCACTGCACTATCAAGTA[C/TCTC,TATCTC,T]
ATCTCGATGTAGTCGTCATCTCGCTGGTAGCGAGGAAGATTTTGCAGGGCACGCCGGTGTGAATATTTTACATTTTAATCATTTTTAAAAACTTTGTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GAGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.10% 0.80% 0.11% 0.00% A: 0.04%; GAGATA: 0.02%
All Indica  2759 98.80% 1.10% 0.11% 0.00% GAGATA: 0.04%
All Japonica  1512 99.50% 0.20% 0.13% 0.00% A: 0.13%
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.00% 0.90% 0.00% 0.00% GAGATA: 0.11%
Indica Intermediate  786 98.70% 1.10% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.10% 0.26% 0.00% A: 0.26%
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433807001 G -> GAGATA LOC_Os04g56690.1 upstream_gene_variant ; 1529.0bp to feature; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> GAGATA LOC_Os04g56700.1 downstream_gene_variant ; 2345.0bp to feature; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> GAGATA LOC_Os04g56690-LOC_Os04g56700 intergenic_region ; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> A LOC_Os04g56690.1 upstream_gene_variant ; 1528.0bp to feature; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> A LOC_Os04g56700.1 downstream_gene_variant ; 2346.0bp to feature; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> A LOC_Os04g56690-LOC_Os04g56700 intergenic_region ; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> GAGA LOC_Os04g56690.1 upstream_gene_variant ; 1529.0bp to feature; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> GAGA LOC_Os04g56700.1 downstream_gene_variant ; 2345.0bp to feature; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0433807001 G -> GAGA LOC_Os04g56690-LOC_Os04g56700 intergenic_region ; MODIFIER N Average:78.783; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433807001 G A 0.02 0.03 0.01 -0.01 0.02 0.03
vg0433807001 G GAGA 0.03 0.05 0.06 -0.22 -0.04 -0.01
vg0433807001 G GAGAT* -0.35 -0.19 -0.19 -0.22 -0.26 -0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433807001 NA 1.11E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 2.63E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 8.44E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 1.06E-14 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 9.44E-07 NA mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 7.25E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 6.58E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 2.57E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 1.30E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 3.36E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 3.16E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 9.18E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 5.79E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433807001 NA 6.86E-41 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251