Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433674026:

Variant ID: vg0433674026 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33674026
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTCCATCTAGAAAAAAACAGAGCCTAAAGCTGATCCAAATTGGTAAGGAGTCCAACAATATTCTGCCGTTACTTTCTTTTCTTCGTCATGCTCTAT[G/A]
AAGTGACAAAGCATGCAAGAGAAACTTGTGTGGCAATTCTTTGATTTTGAAATATTTAAATCAAAATGCTACCTAGGCTTTAGAAATGGAACGAATTGCC

Reverse complement sequence

GGCAATTCGTTCCATTTCTAAAGCCTAGGTAGCATTTTGATTTAAATATTTCAAAATCAAAGAATTGCCACACAAGTTTCTCTTGCATGCTTTGTCACTT[C/T]
ATAGAGCATGACGAAGAAAAGAAAGTAACGGCAGAATATTGTTGGACTCCTTACCAATTTGGATCAGCTTTAGGCTCTGTTTTTTTCTAGATGGAATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.60% 0.87% 0.00% NA
All Indica  2759 75.40% 23.70% 0.94% 0.00% NA
All Japonica  1512 30.20% 69.20% 0.53% 0.00% NA
Aus  269 82.20% 16.40% 1.49% 0.00% NA
Indica I  595 74.60% 24.90% 0.50% 0.00% NA
Indica II  465 88.80% 10.80% 0.43% 0.00% NA
Indica III  913 72.70% 26.50% 0.77% 0.00% NA
Indica Intermediate  786 71.10% 27.10% 1.78% 0.00% NA
Temperate Japonica  767 2.90% 96.50% 0.65% 0.00% NA
Tropical Japonica  504 77.80% 22.00% 0.20% 0.00% NA
Japonica Intermediate  241 17.80% 81.30% 0.83% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433674026 G -> A LOC_Os04g56490.1 upstream_gene_variant ; 2291.0bp to feature; MODIFIER silent_mutation Average:82.097; most accessible tissue: Minghui63 root, score: 98.139 N N N N
vg0433674026 G -> A LOC_Os04g56480.1 downstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:82.097; most accessible tissue: Minghui63 root, score: 98.139 N N N N
vg0433674026 G -> A LOC_Os04g56500.1 downstream_gene_variant ; 2291.0bp to feature; MODIFIER silent_mutation Average:82.097; most accessible tissue: Minghui63 root, score: 98.139 N N N N
vg0433674026 G -> A LOC_Os04g56480.2 downstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:82.097; most accessible tissue: Minghui63 root, score: 98.139 N N N N
vg0433674026 G -> A LOC_Os04g56480.3 downstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:82.097; most accessible tissue: Minghui63 root, score: 98.139 N N N N
vg0433674026 G -> A LOC_Os04g56480-LOC_Os04g56490 intergenic_region ; MODIFIER silent_mutation Average:82.097; most accessible tissue: Minghui63 root, score: 98.139 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433674026 G A -0.06 0.02 0.0 0.01 0.02 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433674026 NA 8.80E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.02E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 6.43E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.32E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 4.85E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 2.61E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 2.07E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.74E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.50E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.78E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.18E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 2.20E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 4.67E-15 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.27E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.23E-12 mr1879 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 2.79E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 6.31E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.11E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 3.14E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 1.68E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433674026 NA 6.07E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251