\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433624149:

Variant ID: vg0433624149 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33624149
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.14, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGGGATGAAACTAAGGGTGCAAGTGGCTACCCGCGAAAACCTATTTATAGGCTAAACTAACCCGCGAACTCACTTATTTTGACCTATAAATGGGTTCG[T/C]
GGGTGACCCACTTGCACCCCTAGATGAAAGAAGATTATGAGTGAAATTTCGAATGGTTTTCTAGAATTCAAATTTGAAACAGTAAAATTCAACCAAAATT

Reverse complement sequence

AATTTTGGTTGAATTTTACTGTTTCAAATTTGAATTCTAGAAAACCATTCGAAATTTCACTCATAATCTTCTTTCATCTAGGGGTGCAAGTGGGTCACCC[A/G]
CGAACCCATTTATAGGTCAAAATAAGTGAGTTCGCGGGTTAGTTTAGCCTATAAATAGGTTTTCGCGGGTAGCCACTTGCACCCTTAGTTTCATCCCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 48.50% 0.49% 0.06% NA
All Indica  2759 76.10% 23.10% 0.72% 0.07% NA
All Japonica  1512 17.50% 82.30% 0.07% 0.07% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 87.20% 11.90% 0.84% 0.00% NA
Indica II  465 80.00% 19.60% 0.43% 0.00% NA
Indica III  913 71.40% 27.80% 0.77% 0.00% NA
Indica Intermediate  786 70.70% 28.20% 0.76% 0.25% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 48.80% 50.80% 0.20% 0.20% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 35.60% 62.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433624149 T -> C LOC_Os04g56380.1 downstream_gene_variant ; 2742.0bp to feature; MODIFIER silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N
vg0433624149 T -> C LOC_Os04g56390.1 downstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N
vg0433624149 T -> C LOC_Os04g56400.1 downstream_gene_variant ; 183.0bp to feature; MODIFIER silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N
vg0433624149 T -> C LOC_Os04g56400.3 downstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N
vg0433624149 T -> C LOC_Os04g56400.4 downstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N
vg0433624149 T -> C LOC_Os04g56390-LOC_Os04g56400 intergenic_region ; MODIFIER silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N
vg0433624149 T -> DEL N N silent_mutation Average:69.661; most accessible tissue: Minghui63 flag leaf, score: 97.853 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433624149 T C 0.01 -0.01 -0.01 0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433624149 NA 4.17E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 1.69E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 9.40E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 4.24E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 5.83E-10 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 3.47E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 1.48E-06 mr1713 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 3.26E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 3.17E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 5.20E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 2.08E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 5.98E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 2.82E-06 2.81E-06 mr1217_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 5.48E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 2.38E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 2.70E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 7.81E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 8.14E-06 8.13E-06 mr1596_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 5.72E-08 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 3.96E-08 mr1713_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 2.25E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 4.78E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 6.72E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 1.87E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 6.31E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 3.46E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433624149 NA 1.06E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251