Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433587363:

Variant ID: vg0433587363 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33587363
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTCACAGTCCTCGCTAAAATCCATGACCTCTTCCATAATTTCACTACATAAATGTTGTAGTAAAAAATTATCCTCCAACTGGTCATCTAATGACTCA[G/A]
TATCAACATTAGGGGTACAAACTTGATTAATAGAAGAACAAGCACATCCGCTTATCCTATTATTTTCTACACATTTCAAATCATTAATTACATCATCTAA

Reverse complement sequence

TTAGATGATGTAATTAATGATTTGAAATGTGTAGAAAATAATAGGATAAGCGGATGTGCTTGTTCTTCTATTAATCAAGTTTGTACCCCTAATGTTGATA[C/T]
TGAGTCATTAGATGACCAGTTGGAGGATAATTTTTTACTACAACATTTATGTAGTGAAATTATGGAAGAGGTCATGGATTTTAGCGAGGACTGTGAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	5.90%	0.42%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	87.40%	11.80%	0.79%	0.00%	NA
Aus	269	65.10%	32.70%	2.23%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	64.50%	33.90%	1.59%	0.00%	NA
Japonica Intermediate	241	96.30%	2.50%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433587363	G -> A	LOC_Os04g56340.1	downstream_gene_variant ; 1285.0bp to feature; MODIFIER	silent_mutation	Average:20.975; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg0433587363	G -> A	LOC_Os04g56350.1	downstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:20.975; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg0433587363	G -> A	LOC_Os04g56340-LOC_Os04g56350	intergenic_region ; MODIFIER	silent_mutation	Average:20.975; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433587363	NA	6.20E-07	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	9.93E-07	9.93E-07	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	NA	5.03E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	NA	2.77E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	NA	5.23E-06	mr1625	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	5.74E-06	5.74E-06	mr1796	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	NA	2.10E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363	NA	2.03E-08	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251