\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433587363:

Variant ID: vg0433587363 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33587363
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTCACAGTCCTCGCTAAAATCCATGACCTCTTCCATAATTTCACTACATAAATGTTGTAGTAAAAAATTATCCTCCAACTGGTCATCTAATGACTCA[G/A]
TATCAACATTAGGGGTACAAACTTGATTAATAGAAGAACAAGCACATCCGCTTATCCTATTATTTTCTACACATTTCAAATCATTAATTACATCATCTAA

Reverse complement sequence

TTAGATGATGTAATTAATGATTTGAAATGTGTAGAAAATAATAGGATAAGCGGATGTGCTTGTTCTTCTATTAATCAAGTTTGTACCCCTAATGTTGATA[C/T]
TGAGTCATTAGATGACCAGTTGGAGGATAATTTTTTACTACAACATTTATGTAGTGAAATTATGGAAGAGGTCATGGATTTTAGCGAGGACTGTGAGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 5.90% 0.42% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 87.40% 11.80% 0.79% 0.00% NA
Aus  269 65.10% 32.70% 2.23% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 64.50% 33.90% 1.59% 0.00% NA
Japonica Intermediate  241 96.30% 2.50% 1.24% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433587363 G -> A LOC_Os04g56340.1 downstream_gene_variant ; 1285.0bp to feature; MODIFIER silent_mutation Average:20.975; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0433587363 G -> A LOC_Os04g56350.1 downstream_gene_variant ; 2469.0bp to feature; MODIFIER silent_mutation Average:20.975; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0433587363 G -> A LOC_Os04g56340-LOC_Os04g56350 intergenic_region ; MODIFIER silent_mutation Average:20.975; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433587363 NA 6.20E-07 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 9.93E-07 9.93E-07 mr1068 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 NA 5.03E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 NA 2.77E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 NA 5.23E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 5.74E-06 5.74E-06 mr1796 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 NA 2.10E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433587363 NA 2.03E-08 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251