\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433424538:

Variant ID: vg0433424538 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33424538
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTGATTATGCTTCCATTTTCCCCTTCCTTTCTCACCAAGTAAACTATTTTAATGATTTTTAAACAATGGTTTGTTAAAACCATACCACCCTATATTT[A/G]
CAAAATTTGAGATATGCCATCCATATCTTAATTACATGTAGGACCTACATGAGTCAATGACATGTGGGTCAGGGTGACATATCATAAATTTTGCAAAATT

Reverse complement sequence

AATTTTGCAAAATTTATGATATGTCACCCTGACCCACATGTCATTGACTCATGTAGGTCCTACATGTAATTAAGATATGGATGGCATATCTCAAATTTTG[T/C]
AAATATAGGGTGGTATGGTTTTAACAAACCATTGTTTAAAAATCATTAAAATAGTTTACTTGGTGAGAAAGGAAGGGGAAAATGGAAGCATAATCAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.30% 44.40% 0.55% 8.78% NA
All Indica  2759 71.50% 13.50% 0.83% 14.14% NA
All Japonica  1512 2.70% 96.90% 0.00% 0.40% NA
Aus  269 30.90% 66.50% 0.37% 2.23% NA
Indica I  595 82.40% 5.20% 0.34% 12.10% NA
Indica II  465 72.30% 17.20% 0.43% 10.11% NA
Indica III  913 67.60% 17.30% 0.88% 14.24% NA
Indica Intermediate  786 67.60% 13.10% 1.40% 17.94% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 6.30% 93.10% 0.00% 0.60% NA
Japonica Intermediate  241 2.50% 96.70% 0.00% 0.83% NA
VI/Aromatic  96 66.70% 27.10% 0.00% 6.25% NA
Intermediate  90 30.00% 60.00% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433424538 A -> DEL N N silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56120.1 upstream_gene_variant ; 1236.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56130.1 upstream_gene_variant ; 2316.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56140.1 upstream_gene_variant ; 4539.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56140.2 upstream_gene_variant ; 4539.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56140.3 upstream_gene_variant ; 4539.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56110.1 downstream_gene_variant ; 3334.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56110.2 downstream_gene_variant ; 3334.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56110.3 downstream_gene_variant ; 3334.0bp to feature; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0433424538 A -> G LOC_Os04g56120-LOC_Os04g56130 intergenic_region ; MODIFIER silent_mutation Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433424538 NA 2.86E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 7.63E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 2.83E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 6.12E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 2.18E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 5.82E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.40E-23 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 3.29E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.66E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.51E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.97E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 9.74E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.24E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 4.23E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 6.81E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.09E-22 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.21E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 2.03E-06 NA mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 3.38E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 6.73E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 7.70E-12 mr1940_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538 NA 1.72E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251