Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433424538:

Variant ID: vg0433424538 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33424538
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

CAACTGATTATGCTTCCATTTTCCCCTTCCTTTCTCACCAAGTAAACTATTTTAATGATTTTTAAACAATGGTTTGTTAAAACCATACCACCCTATATTT[A/G]
CAAAATTTGAGATATGCCATCCATATCTTAATTACATGTAGGACCTACATGAGTCAATGACATGTGGGTCAGGGTGACATATCATAAATTTTGCAAAATT

Reverse complement sequence

AATTTTGCAAAATTTATGATATGTCACCCTGACCCACATGTCATTGACTCATGTAGGTCCTACATGTAATTAAGATATGGATGGCATATCTCAAATTTTG[T/C]
AAATATAGGGTGGTATGGTTTTAACAAACCATTGTTTAAAAATCATTAAAATAGTTTACTTGGTGAGAAAGGAAGGGGAAAATGGAAGCATAATCAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.30%	44.40%	0.55%	8.78%	NA
All Indica	2759	71.50%	13.50%	0.83%	14.14%	NA
All Japonica	1512	2.70%	96.90%	0.00%	0.40%	NA
Aus	269	30.90%	66.50%	0.37%	2.23%	NA
Indica I	595	82.40%	5.20%	0.34%	12.10%	NA
Indica II	465	72.30%	17.20%	0.43%	10.11%	NA
Indica III	913	67.60%	17.30%	0.88%	14.24%	NA
Indica Intermediate	786	67.60%	13.10%	1.40%	17.94%	NA
Temperate Japonica	767	0.40%	99.50%	0.00%	0.13%	NA
Tropical Japonica	504	6.30%	93.10%	0.00%	0.60%	NA
Japonica Intermediate	241	2.50%	96.70%	0.00%	0.83%	NA
VI/Aromatic	96	66.70%	27.10%	0.00%	6.25%	NA
Intermediate	90	30.00%	60.00%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433424538	A -> DEL	N	N	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56120.1	upstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56130.1	upstream_gene_variant ; 2316.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56140.1	upstream_gene_variant ; 4539.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56140.2	upstream_gene_variant ; 4539.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56140.3	upstream_gene_variant ; 4539.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56110.1	downstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56110.2	downstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56110.3	downstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N
vg0433424538	A -> G	LOC_Os04g56120-LOC_Os04g56130	intergenic_region ; MODIFIER	silent_mutation	Average:50.163; most accessible tissue: Zhenshan97 root, score: 87.281	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433424538	NA	2.86E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	7.63E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	2.83E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	6.12E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	2.18E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	5.82E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.40E-23	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	3.29E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.66E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.51E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.97E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	9.74E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.24E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	4.23E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	6.81E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.09E-22	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.21E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	2.03E-06	NA	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	3.38E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	6.73E-21	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	7.70E-12	mr1940_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433424538	NA	1.72E-16	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251