\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433416660:

Variant ID: vg0433416660 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33416660
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTGATAAAACAACTCATAACAAAATAAATTACAATTACGTAAAGTTTTTAAATAAGACGAATGGTTAAACATGTGAGAAAAGGTCAATGTCATCATTT[A/G,T]
TTAAAAAACGGAGGGAGTATATATAAGGAACGCGTTAGGGAGGGAGCTCAGGAGGATATGCGAATAGATAACAAAAGTCAATAGCTTCAAGCAGTTGTTG

Reverse complement sequence

CAACAACTGCTTGAAGCTATTGACTTTTGTTATCTATTCGCATATCCTCCTGAGCTCCCTCCCTAACGCGTTCCTTATATATACTCCCTCCGTTTTTTAA[T/C,A]
AAATGATGACATTGACCTTTTCTCACATGTTTAACCATTCGTCTTATTTAAAAACTTTACGTAATTGTAATTTATTTTGTTATGAGTTGTTTTATCACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 45.80% 0.32% 0.06% T: 0.04%
All Indica  2759 87.90% 11.50% 0.47% 0.11% T: 0.04%
All Japonica  1512 2.70% 97.30% 0.00% 0.00% NA
Aus  269 11.90% 87.70% 0.37% 0.00% NA
Indica I  595 94.10% 5.20% 0.34% 0.34% NA
Indica II  465 85.80% 13.30% 0.65% 0.22% NA
Indica III  913 84.70% 15.10% 0.22% 0.00% NA
Indica Intermediate  786 88.30% 10.80% 0.76% 0.00% T: 0.13%
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 90.60% 0.00% 0.00% T: 1.04%
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433416660 A -> DEL N N silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> G LOC_Os04g56100.1 upstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> G LOC_Os04g56110.1 upstream_gene_variant ; 1845.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> G LOC_Os04g56110.2 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> G LOC_Os04g56110.3 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> G LOC_Os04g56120.1 downstream_gene_variant ; 4875.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> G LOC_Os04g56100-LOC_Os04g56110 intergenic_region ; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> T LOC_Os04g56100.1 upstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> T LOC_Os04g56110.1 upstream_gene_variant ; 1845.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> T LOC_Os04g56110.2 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> T LOC_Os04g56110.3 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> T LOC_Os04g56120.1 downstream_gene_variant ; 4875.0bp to feature; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N
vg0433416660 A -> T LOC_Os04g56100-LOC_Os04g56110 intergenic_region ; MODIFIER silent_mutation Average:80.856; most accessible tissue: Minghui63 root, score: 95.156 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433416660 A G 0.0 -0.05 -0.03 -0.02 -0.02 -0.04
vg0433416660 A T -0.04 -0.07 -0.07 -0.01 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433416660 NA 7.50E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 7.74E-25 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 5.52E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 5.23E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 5.68E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.50E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.74E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 3.23E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.36E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 2.79E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.02E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 8.21E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 5.45E-06 NA mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.82E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 4.37E-06 mr1324_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 2.66E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 2.77E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 7.80E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 3.52E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 8.32E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 3.29E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 4.95E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 9.08E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 7.31E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 2.14E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.84E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 2.63E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 7.86E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 9.81E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 8.52E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 8.19E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 1.25E-06 NA mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 1.80E-10 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 2.40E-08 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 7.94E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 4.87E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 3.07E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 8.12E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433416660 NA 3.46E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251